Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU144651

Sigma-Aldrich

MISSION® esiRNA

targeting human SDHB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF

Date d'expédition estimée le15 avril 2025

Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF

Date d'expédition estimée le15 avril 2025

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCATGCAGAGAAGGCATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACTCTAGCTTGCACCCGAAGGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCTTCCACACATGTATGTGATAAAGGATCTTGTTCCCGATTTGAGCAACTTCTATGCACAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCTCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGTGAGAAACTGGACGGGCTCTACGAGTGCATTCTCTGTGCCTGCTGTAGCACCAGCTGCCCCAGCTACTGGTGGAACGGAGACAAATATCTGGGGCCTGCAGTTCTTATGCAGGCCTATCGCTGGATGATTGACTCCAGAGATGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCATTCTCTCTATACCGCTGCCACACCATCATGAACTGCACAAGG

Numéro d'accès Ensembl | humain

ENSG00000117118

Numéro d'accès NCBI

NM_003000

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SDHB(6390) , SDHB(6390)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
YVT
EJT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yi Li et al.
Free radical biology & medicine, 126, 1-14 (2018-07-22)
In response to hypoxic succinate accumulates in arthritis synovium, however, the implication is little known. This study aims to investigate whether succinate could act as a metabolic signal linking metabolic alternation with angiogenesis in arthritis synovium. The interaction between elevated
Sascha Rahn et al.
Cancers, 12(1) (2019-12-28)
Pancreatic ductal adenocarcinoma (PDAC) is amongst the most fatal malignancies and its development is highly associated with inflammatory processes such as chronic pancreatitis (CP). Since the succinate dehydrogenase subunit B (SDHB) is regarded as tumor suppressor that is lost during
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique