Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU091241

Sigma-Aldrich

MISSION® esiRNA

targeting human GRB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATGCCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCTTTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGTTTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAGTGGGCTGGTATTCTCTCTATGCAAAATGTCTGTTTTAGTTGGAATGACTGAAAGAAGAACAGCTGTTCCTGTGTTCTTCGTATATACACACAAAAAGGAGCGGGCAGGGCCGCTCGATGCCTTTGCTGTTTAGCTTCCTCCAGAGGAGGGGACTTGTAGGAATCTGCCTTCCAGCCCAGACCCCCAGTGTATTTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mathieu J F Crupi et al.
Oncogene, 39(6), 1361-1377 (2019-10-28)
The RET receptor tyrosine kinase plays important roles in regulating cellular proliferation, migration, and survival in the normal development of neural crest derived tissues. However, aberrant activation of RET, through oncogenic mutations or overexpression, can contribute to tumourigenesis, regional invasion
Yueyue Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 133, 111056-111056 (2021-01-01)
Pulmonary arterial hypertension (PAH) is a progressive and lethal cardiopulmonary. Pulmonary vascular remodeling (PVR) caused by excessive proliferation and apoptosis resistance of pulmonary artery smooth muscle cells (PASMCs) is the chief pathological feature of PAH. Dioscin is a natural product
Yolaine Cavignac et al.
PloS one, 10(6), e0131614-e0131614 (2015-06-30)
While it is well established that human cytomegalovirus (HCMV) upregulates many cellular proteins and incorporates several of them into its virion, little is known about the functional relevance of such virus-host interactions. Two cellular proteins, Grb2 and DDX3, gained our

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique