Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU071571

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF


Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGCTCCTCTGACAAGACCATCAAGGTGTGGGACACATGTACCACCTACAAGTGTCAGAAGACACTGGAGGGCCATGATGGCATCGTGCTGGCTCTCTGCATCCAGGGGTGCAAACTCTACAGCGGCTCTGCAGACTGCACCATCATTGTGTGGGACATCCAGAACCTGCAGAAGGTGAACACCATCCGGGCCCATGACAACCCGGTGTGCACGCTGGTCTCCTCACACAACGTGCTCTTCAGCGGCTCCCTGAAGGCCATCAAGGTCTGGGACATCGTGGGCACTGAGCTGAAGTTGAAGAAGGAGCTCACAGGCCTCAACCACTGGGTGCGGGCCCTGGTGGCTGCCCAGAGCTACCTGTACAGCGGCTCCTACCAGACAATCAAGATCTGGGACATCCGAACCCTTGACTGCATCCACGTCCTGCAGACGTCTGGTGGCAGCGTCTACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dawei Xu et al.
Neuropeptides, 71, 81-89 (2018-08-14)
TNF receptor-associated factor 7 (TRAF7), is an E3 ubiquitin ligase for several proteins involved in the activation of TLR-dependent NF-kappaB signaling. TRAF7 links TNF receptor family proteins to signaling pathways, thus participates in regulating cell death and survival mediated by
Keisuke Shirakura et al.
Journal of cell science, 132(1) (2018-12-05)
Roundabout guidance receptor 4 (Robo4) is an endothelial cell-specific receptor that stabilizes the vasculature in pathological angiogenesis. Although Robo4 has been shown to suppress vascular hyperpermeability induced by vascular endothelial growth factor (VEGF) in angiogenesis, the role of Robo4 in

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique