Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU067451

Sigma-Aldrich

MISSION® esiRNA

targeting human MEN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTCTGAGCCCATGTTCTGCCCCCAGCCCAAAGGGGACAGGCCTCACCTCTACCCAAACCCTAGGTTCCCGGTCCCGAGTACAGTCTGTATCAAACCCACGATTTTCTCCAGCTCAGAACCCAGGGCTCTGCCCCAGTCGTTAGAATATAGGTCTCTTCTCCCAGAATCCCAGCCGGCCAATGGAAACCTCACGCTGGGTCCTAATTACCAGTCTTTAAAGGCCCAGCCCCTAGAAACCCAAGCTCCTCCTCGGAACCGCTCACCTAGAGCCAGACCAACGTTACTCAGGGCTCCTCCCAGCTTGTAGGAGCTGAGGTTTCACCCTTAACCCAAGGAGCACAGGTCCCACCTCCAGCCCGGGAGCCTAGGACCACTCAGCCCCTAGGAGTATATTTCCGCACTTCAGAATTCC

Numéro d'accès Ensembl | humain

ENSG00000133895

Numéro d'accès NCBI

NM_130799

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MEN1(4221) , MEN1(4221)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Giulia Stefania Tavanti et al.
International journal of molecular sciences, 22(4) (2021-03-07)
The Hippo pathway is involved in human tumorigenesis and tissue repair. Here, we investigated the Hippo coactivator Yes-associated protein 1 (YAP1) and the kinase large tumor suppressor 1/2 (LATS1/2) in tumors of the parathyroid glands, which are almost invariably associated
Annamaria Morotti et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Laurent Ehrlich et al.
The American journal of pathology, 187(3), 570-580 (2017-01-15)
Menin (MEN1) is a tumor-suppressor protein in neuroendocrine tissue. Therefore, we tested the novel hypothesis that menin regulates cholangiocarcinoma proliferation. Menin and miR-24 expression levels were measured in the following intrahepatic and extrahepatic cholangiocarcinoma (CCA) cell lines, Mz-ChA-1, TFK-1, SG231

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique