Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU109591

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCTGAGCAACAGAAAAAGGCGGCCATCATCTCTGCTGAGGGCGACTCCAAGGCAGCTGAGCTGATTGCCAACTCACTGGCCACTGCAGGGGATGGCCTGATCGAGCTGCGCAAGCTGGAAGCTGCAGAGGACATCGCGTACCAGCTCTCACGCTCTCGGAACATCACCTACCTGCCAGCGGGGCAGTCCGTGCTCCTCCAGCTGCCCCAGTGAGGGCCCACCCTGCCTGCACCTCCGCGGGCTGACTGGGCCACAGCCCCGATGATTCTTAACACAGCCTTCCTTCTGCTCCCACCCCAGAAATCACTGTGAAATTTCATGATTGGCTTAAAGTGAAGGAAATAAAGGTAAAATCACTTCAGATCTCTAATTAGTCTATCAAATGAAACTCTTTCATTCTTCTCACATCCATCTACTTTTTTATCCACCTCCCTACCAAAAATTGCCAAGTGCCTATGCAAACCAGCT

Numéro d'accès Ensembl | humain

ENSG00000167085

Numéro d'accès NCBI

NM_002634

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PHB(5245) , PHB(5245)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lijun Sun et al.
Biochemical and biophysical research communications, 513(2), 446-451 (2019-04-11)
Influenza virus infection is associated with type 1 diabetes (T1DM), but its pathogenesis remains unclear. Here, our study found that one of the monoclonal antibodies against H1N1 influenza virus hemagglutinin(HA) cross-reacted with human pancreatic tissue and further demonstrated that it
Debabrata Chowdhury et al.
Molecular and cellular biochemistry, 425(1-2), 155-168 (2016-11-18)
Numerous hypertrophic stimuli, including β-adrenergic agonists such as isoproterenol (ISO), result in generation of reactive oxygen species (ROS) and alteration in the mitochondrial membrane potential (Δψ) leading to oxidative stress. This process is well associated with phosphorylation of thymoma viral
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and
Kinnosuke Yahiro et al.
Cellular microbiology, 21(8), e13033-e13033 (2019-04-23)
Vibrio cholerae produced-Cholix toxin (Cholix) is a cytotoxin that ADP-ribosylates eukaryotic elongation factor 2, inhibiting protein synthesis, and inducing apoptosis. Here, we identified prohibitin (PHB) 1 and 2 as novel Cholix-interacting membrane proteins in immortalised human hepatocytes and HepG2 cells
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique