Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU028021

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAGAAACTTCAGGCAGAACATCCATTCATTCATTCATTGGATTGTATATCATTGTTGCACAATCAGAATTGATAAGCACTGTTCCTCCACTCCAT

Numéro d'accès Ensembl | humain

ENSG00000137673

Numéro d'accès NCBI

NM_002423

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MMP7(4316) , MMP7(4316)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ahmad Ghasemi et al.
Journal of cellular biochemistry, 119(2), 2333-2344 (2017-09-09)
Leptin, an adipokine secreted by adipose tissue, induces cell invasion and metastasis. MMP7 is a member of the matrix metalloproteinase family that plays an important role in cell invasion. Here we evaluate the possible role and underlying mechanism of MMP7
Sojoong Choi et al.
Oncotarget, 6(6), 3874-3886 (2015-02-18)
Because earlier studies showed the cell surface heparan sulfate proteoglycan, syndecan-2, sheds from colon cancer cells in culture, the functional roles of shed syndecan-2 were assessed. A non-cleavable mutant of syndecan-2 in which the Asn148-Leu149 residues were replaced with Asn148-Ile149
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the
Q Zhang et al.
Oncogene, 36(5), 687-699 (2016-07-05)
Chronic inflammation has been associated with a variety of human cancers including prostate cancer. Interleukin-17 (IL-17) is a critical pro-inflammatory cytokine, which has been demonstrated to promote development of prostate cancer, colon cancer, skin cancer, breast cancer, lung cancer and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique