Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU023041

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0C, RP11-20I23.1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAACTCCCTGAATGACGACATCAGCCTCTACAAGAGCTTCCTCCAGCTGGGCGCCGGCCTGAGCGTGGGCCTGAGCGGCCTGGCAGCCGGCTTTGCCATCGGCATCGTGGGGGACGCTGGCGTGCGGGGCACCGCCCAGCAGCCCCGACTATTCGTGGGCATGATCCTGATTCTCATCTTCGCCGAGGTGCTCGGCCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAGACCCTCTCCGAGCCCACCAGCCACAGAATATTATGTAAAGACCACCCCTCCTCATTCCAGAACGAACAGCCTGACACATACGCACGGGGCCGCCGCCCCCAGTAGTTGGTCTTGTACATGCGCAGTGTCCTAGTGCCCATCGTCTGTTTCCCCGGCCTTGCCCCCGCCCGCCCCGTGCCGTGGACATCTGGGCCCACTCATCGCCCCTCCAGGCCCCCGGCGCCCCACCCCCTAGAGTGCTCTGTGTATGCGGATG

Numéro d'accès Ensembl | humain

ENSG00000185883

Numéro d'accès NCBI

NM_001694

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATP6V0C(527) , ATP6V0C(527)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nicholas J Barrows et al.
Scientific reports, 9(1), 9711-9711 (2019-07-06)
Hundreds of cellular host factors are required to support dengue virus infection, but their identity and roles are incompletely characterized. Here, we identify human host dependency factors required for efficient dengue virus-2 (DENV2) infection of human cells. We focused on
Yuji Tani et al.
Scientific reports, 5, 10878-10878 (2015-06-04)
(Pro)renin receptor (PRR) has a single transmembrane domain that co-purifies with the vacuolar H(+)-ATPase (V-ATPase). In addition to its role in cellular acidification, V-ATPase has been implicated in membrane fusion and exocytosis via its Vo domain. Results from the present
Manuela Salerno et al.
PloS one, 9(10), e110340-e110340 (2014-10-21)
Rhabdomyosarcoma is the most frequent soft tissue sarcoma in children and adolescents, with a high rate of relapse that dramatically affects the clinical outcome. Multiagent chemotherapy, in combination with surgery and/or radiation therapy, is the treatment of choice. However, the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique