Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU016661

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A37

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAATCCAGCAGAAGTGGTGAAGCAGCGCTTGCAGATGTACAACTCGCAGCACCGGTCAGCAATCAGCTGCATCCGGACGGTGTGGAGGACCGAGGGGTTGGGGGCCTTCTACCGGAGCTACACCACGCAGCTGACCATGAACATCCCCTTCCAGTCCATCCACTTCATCACCTATGAGTTCCTGCAGGAGCAGGTCAACCCCCACCGGACCTACAACCCGCAGTCCCACATCATCTCAGGCGGGCTGGCCGGGGCCCTCGCCGCGGCCGCCACGACCCCCCTGGACGTCTGTAAGACCCTTCTGAACACTCAGGAGAACGTGGCCCTCTCGCTGGCCAACATCAGCGGCCGGCTGTCGGGTATGGCCAATGCCTTCCGGACGGTGTACCAGCTCAACGGCCCGGCTACTTCAAAGGCATCCAGGC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kazuo Tomita et al.
Biochemical and biophysical research communications, 518(4), 712-718 (2019-09-02)
MicroRNA (miRNA) is a non-coding RNA involved in regulating both cancer gene promotion and suppression. We investigated the role of miRNA in inducing radiation resistance in cancer cell lines using clinically relevant radioresistant (CRR) cells. Analysis using miRNA arrays and
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique