Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU016631

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNIP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF

Check Cart for Availability
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF

Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAG

Numéro d'accès Ensembl | humain

ENSG00000117289

Numéro d'accès NCBI

NM_006472

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TXNIP(10628) , TXNIP(10628)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
SYU
HQS
XHS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jianjun Jiang et al.
Lipids in health and disease, 20(1), 19-19 (2021-02-23)
This study aimed to explore the effects of ceramide (Cer) on NLRP3 inflammasome activation and their underlying mechanisms. Lipopolysaccharide (LPS)/adenosine triphosphate (ATP)-induced NLRP3 inflammasome activation in J774A.1 cells and THP-1 macrophages was used as an in vitro model of inflammation.
Tina Oberacker et al.
FEBS letters, 592(13), 2297-2307 (2018-06-14)
The "free radical theory of aging" suggests that reactive oxygen species (ROS) are responsible for age-related loss of cellular functions and, therefore, represent the main cause of aging. Redox regulation by thioredoxin-1 (TRX) plays a crucial role in responses to
Takhellambam S Devi et al.
Biology open, 8(4) (2019-04-27)
Thioredoxin-interacting protein (TXNIP) plays a critical role in oxidative stress, inflammation, apoptosis and the pathogenesis of diabetic retinopathy (DR). However, the role of TXNIP in high glucose-induced retinal pigment epithelium (RPE) dysfunction is still unknown. Here, we show that high
Chad N Brocker et al.
Nature communications, 11(1), 5847-5847 (2020-11-19)
Exploring the molecular mechanisms that prevent inflammation during caloric restriction may yield promising therapeutic targets. During fasting, activation of the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) promotes the utilization of lipids as an energy source. Herein, we show that
Yu Tian et al.
Neurochemical research, 45(2), 428-436 (2019-12-21)
Ischemic stroke is a life-threatening cerebrovascular thrombotic disease, oxidative stress is considered to be a critical factor to stroke pathophysiology. This study aimed to investigate the underlying molecular mechanism and propose the potential therapeutic strategy for ischemic stroke. Bioinformatics analysis
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique