Alle Fotos(1)
Wichtige Dokumente
HLTUD2167
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-6125
Synonym(e):
Tough Decoy, TuD
Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)
About This Item
UNSPSC-Code:
41106609
NACRES:
NA.51
Qualitätsniveau
Produktlinie
MISSION®
Konzentration
≥1x106 VP/ml (via p24 assay)
Methode(n)
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
Ausgereifte Sequenz
GCGGAAGGCGGAGCGGCGGA
Sanger-Hinterlegungsnummer ausgereifte/nicht ausgereifte Sequenzen
Sanger microRNA-Hinterlegungsnummer
Versandbedingung
dry ice
Lagertemp.
−70°C
Allgemeine Beschreibung
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Sonstige Hinweise
Based on miRBase V19 Mature ID
Rechtliche Hinweise
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Hier finden Sie alle aktuellen Versionen:
Analysenzertifikate (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.
Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..
Setzen Sie sich mit dem technischen Dienst in Verbindung.