Alle Fotos(1)
Wichtige Dokumente
HLMIR0310
MISSION® Lenti microRNA, Human
hsa-miR-1915-3p
Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)
About This Item
UNSPSC-Code:
41106609
NACRES:
NA.51
Qualitätsniveau
Produktlinie
MISSION®
Form
liquid
Konzentration
≥1x106 VP/ml (via p24 assay)
Ausgereifte Sequenz
CCCCAGGGCGACGCGGCGGG
Sanger-Hinterlegungsnummer ausgereifte/nicht ausgereifte Sequenzen
Sanger microRNA-Hinterlegungsnummer
Versandbedingung
dry ice
Lagertemp.
−70°C
Allgemeine Beschreibung
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Sonstige Hinweise
Based on miRBase V20 Mature ID
Empfohlene Produkte
Two negative controls are available: NCLMIR001 and NCLMIR002
Rechtliche Hinweise
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Kontrolle
Produkt-Nr.
Beschreibung
Preisangaben
Lagerklassenschlüssel
12 - Non Combustible Liquids
WGK
WGK 3
Flammpunkt (°F)
Not applicable
Flammpunkt (°C)
Not applicable
Hier finden Sie alle aktuellen Versionen:
Analysenzertifikate (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.
Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..
Setzen Sie sich mit dem technischen Dienst in Verbindung.