Direkt zum Inhalt
Merck

EMU066761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fyb

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Voraussichtliches Versanddatum14. April 2025



Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Voraussichtliches Versanddatum14. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGCCTCAGACTTCCCTCCTCCACCTGCAGAGATGAGTCAAGGAATGAGTGTTGGAAGGGCAAAAACGGAAGAGAAAGATCCCAAGAAGCTAAAAAAGCAAGAAAAGGAAGAAAAAGACCTCAGGAAAAAATTTAAGTACGACGGTGAAATTCGAGTTCTATATTCAACTAAAGTTGCGTCCTCCTTAACCTCTAAAAAGTGGGGAGCGAGAGATCTGCAGATAAAACCTGGGGAGTCACTCGAAGTTATACAAAGCACAGATGACACCAAAGTTCTCTGCAGGAATGAAGAGGGCAAATATGGTTATGTCCTTCGGAGTTACCTGGTGGACAATGATGGAGAAATCTATGACGACATCGCTGATGGTTGCATCTATGACAATGACTAGCACTCTGCTCTGTTCATTCCACTGTGCC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Fang Wang et al.
Folia histochemica et cytobiologica, 58(2), 96-107 (2020-06-27)
Growing evidence indicates that Rictor (Rapamycin-insensitive companion of mTOR) is overexpressed across several malignancies and associated with poor survival. However, only limited data indicate that Rictor plays a role in gastric cancer (GC). We sought to explore the prognostic value
Mahmoud A Chawsheen et al.
Cellular signalling, 81, 109934-109934 (2021-02-06)
Lung cancer has a poor prognosis partly due to a lack of response to treatments such as the chemotherapy drug gemcitabine. Combinations of chemotherapy drugs with signal transduction inhibitors may be more effective treatments. In this study we have investigated
Zhaoming Lu et al.
Acta pharmaceutica Sinica. B, 10(6), 1004-1019 (2020-07-10)
Dysregulation of mTORC1/mTORC2 pathway is observed in many cancers and mTORC1 inhibitors have been used clinically in many tumor types; however, the mechanism of mTORC2 in tumorigenesis is still obscure. Here, we mainly explored the potential role of mTORC2 in
Li Feng et al.
Pharmaceutical biology, 57(1), 586-594 (2019-09-08)
Context: Evidence suggests that microRNA (miRNA) regulate gene expression and bone tissue homoeostasis of osteoporosis. MiR-152 has found to be abnormally expressed in osteoporosis, but its role in osteoblast differentiation has not been elucidated. Objective: To understand the potential mechanism
Thomas Jansson et al.
Clinical science (London, England : 1979), 134(1), 53-70 (2019-12-12)
Intrauterine growth restriction (IUGR) increases the risk for perinatal complications and metabolic and cardiovascular disease later in life. The syncytiotrophoblast (ST) is the transporting epithelium of the human placenta, and decreased expression of amino acid transporter isoforms in the ST

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.