Direkt zum Inhalt
Merck

EMU061231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCAGTTCTGCCAGCTTGGTGTCATCACAAGCTAGTTCCAGCTCCTTTTTCACCAATGCCAATAGTTATTCAACAACTACTACCACCAGCAACATGGGAATTATGAACTTTACCAGCAGTGGTTCATCAGGGACTAGTTCTCAAGGCCAGACGCCCCAGAGGGTTGGTGGGCTACAAGGGTCTGATTCTCTGAACATCCAGCAGAACCAGACATCAGGAGGCTCGCTGCAAGGAAGTCAGCAGAAAGAGGGAGAGCAAAGTCAGCAGACACAGCAACAACAAATTCTTATTCAGCCTCAGCTAGTTCAAGGAGGACAAGCTCTTCAGGCCCTTCAAGCAGCACCATTGTCCGGACAGACCTTCACAACTCAAGCTATTTCCCAGGAAACCCTTCAGAACCTCC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kazuo Asanoma et al.
Molecular and cellular biology, 35(24), 4096-4109 (2015-09-24)
BHLHE40 and BHLHE41 (BHLHE40/41) are basic helix-loop-helix type transcription factors that play key roles in multiple cell behaviors. BHLHE40/41 were recently shown to be involved in an epithelial-to-mesenchymal transition (EMT). However, the precise mechanism of EMT control by BHLHE40/41 remains
Li Yan et al.
American journal of cancer research, 5(4), 1447-1459 (2015-06-24)
Recent evidence suggests that miR-520 family has an important role in regulating tumorigenesis and development of various types of solid cancers. However, as one of the most common cancers in the world, there is little known about the underlying regulatory
Sumegha Mitra et al.
PloS one, 9(6), e100169-e100169 (2014-06-19)
Growth arrest DNA damage inducible alpha (GADD45a) is a stress-induced gene we have shown to participate in the pathophysiology of ventilator-induced lung injury (VILI) via regulation of mechanical stress-induced Akt ubiquitination and phosphorylation. The regulation of GADD45a expression by mechanical
Dong-Qin Chen et al.
Oncotarget, 5(10), 3333-3349 (2014-05-17)
Chemoresistance is one of the most significant obstacles in lung adenocarcinoma (LAD) treatment, and this process involves genetic and epigenetic dysregulation of chemoresistance-related genes. Previously, we have shown that restoration of microRNA (miR)-200b significantly reverses chemoresistance of human LAD cells
Pablo Secades et al.
Head & neck, 37(8), 1150-1162 (2014-05-07)
We previously showed that activation of epidermal growth factor receptor (EGFR) induces hypoxia inducible factor-1α (HIF-1α) in head and neck squamous cell carcinoma (HNSCC) cells. In this study, we have furthered this by investigating the mechanism of HIF-1α activation by

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.