Direkt zum Inhalt
Merck

EMU052501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTGTGGATCGCCAAATTATGCAGCACCTGAGGTCATCTCAGGAAGGCTGTATGCAGGTCCCGAGGTCGATATCTGGAGCTGTGGTGTCATCCTGTATGCCCTTCTCTGTGGCACCCTCCCTTTCGATGATGAGCACGTGCCTACGCTCTTCAAGAAGATCCGAGGGGGTGTGTTTTACATCCCAGACTATCTCAACCGTTCTGTCGCCACTCTGCTGATGCACATGCTCCAGGTGGACCCCCTGAAGCGAGCGACTATCAAAGACATACGAGAACATGAATGGTTTAAACAGGATTTGCCCAGCTACCTATTTCCTGAAGACCCCTCCTACGATGCGAATGTCATTGTCGATGAGGCTGTGAAGGAAGTCTGTGAGAAATTCGAGTGTACAGAGTCAGAAGTGATGAATAGTCTGTATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTAT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sreevidya Santha et al.
The Journal of biological chemistry, 290(36), 21865-21875 (2015-07-23)
Prostate cancer (PCa) is one of the most frequently diagnosed cancers in men with limited treatment options for the hormone-resistant forms. Development of novel therapeutic options is critically needed to target advanced forms. Here we demonstrate that combinatorial treatment with
Sravanth K Hindupur et al.
Breast cancer research : BCR, 16(4), 420-420 (2014-08-07)
Matrix detachment triggers anoikis, a form of apoptosis, in most normal epithelial cells, while acquisition of anoikis resistance is a prime requisite for solid tumor growth. Of note, recent studies have revealed that a small population of normal human mammary
Xia Cao et al.
Hypertension research : official journal of the Japanese Society of Hypertension, 37(9), 803-810 (2014-06-27)
The purpose of this study was to determine the effects of resveratrol (RSV) and the molecular mechanisms by which it regulates vascular smooth muscle contraction and blood pressure in mice. In cultured human vascular smooth muscle cells (VSMCs), we found
Teraneh Z Jhaveri et al.
Oncotarget, 6(17), 14754-14765 (2015-07-06)
AMP-activated Protein Kinase (AMPK) activity retards growth of many types of cancers. Investigating effects of AMPK activation on breast cancer cell signaling and survival, we found that breast cancer cell lines with amplification and over-expression of HER2 or EGFR are
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.