Direkt zum Inhalt
Merck

EMU049451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cltc

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51
Preise und Verfügbarkeit sind derzeit nicht verfügbar.

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCAGAGCTGGTGTTTCTGTATGACAAGTACGAAGAGTATGACAATGCCATCATTACCATGATGAATCACCCCACCGATGCATGGAAGGAAGGGCAGTTCAAAGACATCATCACCAAGGTGGCTAATGTGGAACTGTACTACAAAGCAATCCAGTTCTACTTAGAATTCAAGCCTTTGTTGTTAAATGACTTGCTCATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTAAAACAGCTACCACTGGTGAAACCATATTTACGCTCAGTGCAGAACCACAACAACAAATCTGTGAATGAATCACTGAACAACCTCTTTATTACTGAAGAAGATTACCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAACATCTCACTTGCTCAGCGTTTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Odette Allonby et al.
Cellular signalling, 26(12), 2645-2657 (2014-08-26)
Ligand-induced internalisation and subsequent downregulation of receptor tyrosine kinases (RTKs) serve to determine biological outputs of their signalling. Intrinsically kinase-deficient RTKs control a variety of biological responses, however, the mechanism of their downregulation is not well understood and its analysis
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced
Cyril Basquin et al.
The EMBO journal, 34(16), 2147-2161 (2015-07-01)
Endocytosis controls many functions including nutrient uptake, cell division, migration and signal transduction. A clathrin- and caveolin-independent endocytosis pathway is used by important physiological cargos, including interleukin-2 receptors (IL-2R). However, this process lacks morphological and dynamic data. Our electron microscopy

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.