Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU021801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcr4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCTGCCCACCATCTACTTCATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTCATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTGCACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGGGCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAGGCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATCCTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACCAACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTGGGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTTGCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000045382

NCBI-Hinterlegungsnummer

NM_009911

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... CXCR4(12767) , Cxcr4(12767)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jordy J Hsiao et al.
BMC cancer, 15, 204-204 (2015-04-18)
Identifying cellular signaling pathways that become corrupted in the presence of androgens that increase the metastatic potential of organ-confined tumor cells is critical to devising strategies capable of attenuating the metastatic progression of hormone-naïve, organ-confined tumors. In localized prostate cancers
Shijie Ma et al.
International journal of clinical oncology, 20(3), 525-530 (2014-08-26)
CXCR4 and glycogen synthase kinase-3β (GSK3β) promote proliferation and invasion of pancreatic cancer. Inhibition of CXCR4 suppresses GSK3β expression. However, the molecular mechanism by which CXCR4 contributes to human pancreatic cancer metastasis is not completely understood. In this study, therefore
Yingzhuan Zhan et al.
Journal of cellular and molecular medicine, 19(7), 1614-1623 (2015-03-11)
The increased migration and invasion of breast carcinoma cells are key events in the development of metastasis to the lymph nodes and distant organs. CXCR4, the receptor for stromal-derived factor-1, is reportedly involved in breast carcinogenesis and invasion. In this
Małgorzata Sekuła et al.
International journal of oncology, 44(6), 1853-1860 (2014-04-15)
Cervical carcinoma is frequently diagnosed among women, particularly in low and middle income countries. In this study, we investigated the role of the SDF-1/CXCR4 axis during cervical carcinoma growth and progression in vitro and in vivo. Downregulation of CXCR4 receptor using an
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.