Direkt zum Inhalt
Merck

EMU008231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGCTTATCAGCGTGGAGGACCTGTGGAAGGCGTGGAAATCATCAGAAGTGTACAACTGGACTGTGGATGAGGTGATACAGTGGCTCATTACGTATGTGGAGCTGCCACAGTATGAGGAGACCTTCCGGAAGTTGCAGCTTACTGGCCACGCCATGCCAAGGCTAGCAGTAACCAACACCACCATGACAGGGACTGTACTGAAGATGACAGATCGGAGCCACAGGCAGAAGCTGCAGCTGAAGGCCCTGGACACAGTGCTGTTTGGGCCTCCTCTCTTGACTCGGCATAATCACCTGAAGGACTTCATGCTGGTGGTGTCTATCGTTATTGGTGTGGGTGGCTGCTGGTTTGCCTATATCCAGAACCGTTACTCTAAGGAGCACATGAAGAAAATGATGAAGGATCTGGAAGGG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ziying Han et al.
PLoS pathogens, 11(10), e1005220-e1005220 (2015-10-30)
Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg) and arenaviruses (Lassa and Junín viruses), are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
J-Y Wang et al.
Oncogene, 34(33), 4358-4367 (2014-11-11)
Tumor metastasis is the major cause of death among cancer patients, with >90% of cancer-related death attributable to the spreading of metastatic cells to secondary organs. Store-operated Ca(2+) entry (SOCE) is the predominant Ca(2+) entry mechanism in most cancer cells
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.