Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU219141

Sigma-Aldrich

MISSION® esiRNA

targeting human UGT1A3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTTCATTGGGGGCATCAACTGTGCCAACAGGAAGCCACTATCTCAGGAATTTGAAGCCTACATTAATGCTTCTGGAGAACATGGAATTGTGGTTTTCTCTTTGGGATCAATGGTCTCAGAAATTCCAGAGAAGAAAGCTATGGCAATTGCTGATGCTTTGGGCAAAATCCCTCAGACAGTCCTGTGGCGGTACACTGGAACCCGACCATCGAATCTTGCGAACAACACGATACTTGTTAAGTGGCTACCCCAAAACGATCTGCTTGGTCACCCGATGACCCGTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGCAATGGCGTTCCCATGGTGATGATGCCCTTGTTTGGTGATCAGATGGACAATGCAAAGCGCATGGAGACTAAGGGAGCTGGAGTGACCCTGAATGTTCTGGAAATGACTTCTGAAGATTTAGAAAATGCTCTAAAAGCAGTCATCAATGACAAAAGTTACAAGGAGAACATCATGCGCCT

Ensembl | Human Hinterlegungsnummer

ENSG00000243135

NCBI-Hinterlegungsnummer

NM_019093

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... UGT1A3(54575) , UGT1A3(54659)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ming-Chieh Shun et al.
Journal of oncology, 2010, 824571-824571 (2010-03-13)
RRR-alpha-tocopherol derivative alpha-TEA (RRR-alpha-tocopherol ether-linked acetic acid analog) has been shown to be a potent antitumor agent both in vivo and in vitro. In this study, we investigated the effects of alpha-TEA on the expression of epidermal growth factor receptor
Jin Chen et al.
Biochemical and biophysical research communications, 501(1), 212-219 (2018-05-02)
We had previously demonstrated that increased expression of ErbB3 is required for ErbB2-mediated paclitaxel resistance in breast cancer cells. In the present study, we have explored the possible role of mesenchymal stem cells (MSCs) in regulating the paclitaxel-sensitivity of ErbB2/ErbB3-coexpressing
Jinkyoung Kim et al.
BMC cancer, 13, 383-383 (2013-08-14)
Heregulin (HRG; also known as neuregulin) is a ligand for ErbB3. One of its isotypes, HRG-β1, binds to ErbB3 and forms heterodimers with other ErbB family members, thereby enhancing the proliferation and tumorigenesis of breast cancer cells. HRG stimulation may
Xueyan Zhou et al.
Nature communications, 5, 4573-4573 (2014-09-04)
Bile acids play a pivotal role in the pathological development of inflammatory bowel disease (IBD). However, the mechanism of bile acid dysregulation in IBD remains unanswered. Here we show that intestinal peroxisome proliferator-activated receptor α (PPARα)-UDP-glucuronosyltransferases (UGTs) signalling is an
Nicolás Sarute et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(32), 19497-19506 (2020-07-29)
Understanding the genetics of susceptibility to infectious agents is of great importance to our ability to combat disease. Here, we show that voltage-gated calcium channels (VGCCs) are critical for cellular binding and entry of the New World arenaviruses Junín and
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.