Direkt zum Inhalt
Merck

EHU157781

Sigma-Aldrich

MISSION® esiRNA

targeting human FLNA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qian Wang et al.
PloS one, 10(4), e0123018-e0123018 (2015-04-11)
Polycystin-2 (PC2), encoded by the PKD2 gene, is mutated in ~15% of autosomal dominant polycystic kidney disease. Filamins are actin-binding proteins implicated in scaffolding and membrane stabilization. Here we studied the effects of filamin on PC2 stability using filamin-deficient human
Anshika Sharma et al.
Frontiers in microbiology, 11, 581867-581867 (2020-10-27)
Influenza A virus (IAV) poses a major threat to global public health and is known to employ various strategies to usurp the host machinery for survival. Due to its fast-evolving nature, IAVs tend to escape the effect of available drugs
Alessandra Mingione et al.
Journal of molecular endocrinology, 58(2), 91-103 (2016-11-23)
Parathyroid tumors display reduced sensitivity to extracellular calcium ([Ca
E Peverelli et al.
Endocrinology, 155(8), 2932-2941 (2014-05-16)
Somatostatin receptor type 2 (SST2) is the main pharmacological target of medical therapy for GH-secreting pituitary tumors, but molecular mechanisms regulating its expression and signaling are largely unknown. The aim of this study was to investigate the role of cytoskeleton
Donatella Treppiedi et al.
Molecular and cellular endocrinology, 524, 111159-111159 (2021-01-12)
Somatostatin receptor type 5 (SST5) represents the main pharmacological target in the treatment of adrenocorticotroph hormone (ACTH)-secreting tumors. However, molecular predictors of responsiveness to pasireotide require further investigation. The cytoskeleton protein filamin A (FLNA) modulates the responsiveness to somatostatin analogs

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.