Direkt zum Inhalt
Merck

EHU157051

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM10

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTTCAAGCTGCTGGAGACCTGCGTCAGTGAGCAGCATGAATACCACTGGCATGATGGTGTGAAGAGGTTTTTCAAATGTCCCTGTGGAAACAGAAGCATCTCCTTGGACAGACTCCCGAACAAGCACTGCAGTAACTGTGGCCTCTACAAATGGGAACGGGACGGAATGCTAAAGGAAAAGACTGGTCCAAAGATAGGAGGAGAAACTCTGTTACCAAGAGGAGAAGAACATGCTAAATTTCTGAACAGCCTTAAATAACCCGAACTTCAGACATTTTCCCACAGACTTCCTGGCCTCCTGTGACTCTGGAAAGCAAAGGATTGGCTGTGTATTGTCCATTGATTCCTGATTGACGCCGTCAAAAACAAATGCTTGTTAAGCCCATAAGCTTTGCCTGCTTACTTTCTGCCATTGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Peng Kang et al.
Journal of molecular neuroscience : MN, 70(5), 759-768 (2020-02-08)
Minichromosome maintenance 10 (MCM10) plays an important role in DNA replication and is expressed in a variety of tumors, including glioma. However, its role and mechanism in glioma remain elusive. The purpose of this study was to examine the molecular
Feilun Cui et al.
The Prostate, 78(16), 1299-1310 (2018-08-11)
Prostate cancer (PCa) is one of the most malignant tumors of the male urogenital system. There is an urgent need to identify novel biomarkers for PCa. In this study, we evaluated the expression levels of MCM10 in prostate cancer by
Wei-Dong Yang et al.
Journal of biochemical and molecular toxicology, 33(7), e22330-e22330 (2019-04-17)
The minichromosome maintenance protein 10 (MCM10) is one of the MCM proteins that initiate DNA replication by interacting with CDC45-MCM2-7. It has been reported that MCM10 has a role in breast cancer progression. However, MCM10 in breast cancer is still not comprehensively
Bizhan Romani et al.
The Journal of biological chemistry, 290(28), 17380-17389 (2015-06-03)
Human immunodeficiency virus type 1 Vpr is an accessory protein that induces G2/M cell cycle arrest. It is well documented that interaction of Vpr with the Cul4-DDB1[VprBP] E3 ubiquitin ligase is essential for the induction of G2/M arrest. In this

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.