Direkt zum Inhalt
Merck

EHU156971

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGAATATGCCATCTCACAGCCTCTGGAAGGGGCTGGGGCCACGTGCCCCACAGGGTCAGAGCCCCTGGCAGGAGAGACGCCCAACCAGGCCCTGAAACCCGGGGCAAAATCCAACAGCATCATTGTGAGCCCTCGGCAGAGGGGCAATCCCGTACTGAAGTTCGTGCGCAATGTGCCCTGGGAATTTGGCGACGTAATTCCCGACTATGTGCTGGGCCAGAGCACCTGTGCCCTGTTCCTCAGCCTCCGCTACCACAACCTGCACCCAGACTACATCCATGGGCGGCTGCAGAGCCTGGGGAAGAACTTCGCCTTGCGGGTCCTGCTTGTCCAGGTGGATGTGAAAGATCCCCAGCAGGCCCTCAAGGAGCTGGCTAAGATGTGTATCCTGGCCGACTGCACATTGATCCTCGCCTGGAGCCCCGAGGAAGCTGGGCGGTACCTGGAGACCTACAAGGCCTATGAGCAGAAACCAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wei-Ping Lee et al.
Biochimica et biophysica acta, 1863(4), 917-928 (2017-01-16)
Gemcitabine and capecitabine are two effective anticancer agents against solid tumors. The pharmacological mechanisms have been known as incorporation into DNA and thereby inhibition of DNA synthesis. When used as metronomic chemotherapy, they may inhibit angiogenesis and induce immunity. In
Jae Joon Han et al.
Cancer research and treatment : official journal of Korean Cancer Association, 46(1), 55-64 (2014-02-13)
The novel heat shock protein tumor necrosis factor receptor-associated protein 1 (TRAP1) is associated with multidrug resistance in colorectal cancer (CRC) cells in vitro. Excision repair cross-complementation group 1 (ERCC1) expression levels in tumor tissues also predict clinical outcomes in
Daniel P Feldmann et al.
Molecules (Basel, Switzerland), 25(8) (2020-04-30)
Platinum-based chemotherapy remains a mainstay treatment for the management of advanced non-small cell lung cancer. A key cellular factor that contributes to sensitivity to platinums is the 5'-3' structure-specific endonuclease excision repair cross-complementation group 1 (ERCC1)/ xeroderma pigmentosum group F
Gianmaria Liccardi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3496-3506 (2014-05-02)
The epidermal growth factor receptor (EGFR) plays an important role in cellular response to chemotherapy and radiotherapy through modulation of DNA repair. EGFR activates DNA-dependent protein kinase (DNA-PK) stimulating repair of DNA strand breaks (SB) and interstrand crosslinks (ICL). We
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.