Direkt zum Inhalt
Merck

EHU153641

Sigma-Aldrich

MISSION® esiRNA

targeting human HRH4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGAATGGGCCAATGATTCTAGTTTCAGAGTCTTGGAAGGATGAAGGTAGTGAATGTGAACCTGGATTTTTTTCGGAATGGTACATCCTTGCCATCACATCATTCTTGGAATTCGTGATCCCAGTCATCTTAGTCGCTTATTTCAACATGAATATTTATTGGAGCCTGTGGAAGCGTGATCATCTCAGTAGGTGCCAAAGCCATCCTGGACTGACTGCTGTCTCTTCCAACATCTGTGGACACTCATTCAGAGGTAGACTATCTTCAAGGAGATCTCTTTCTGCATCGACAGAAGTTCCTGCATCCTTTCATTCAGAGAGACAGAGGAGAAAGAGTAGTCTCATGTTTTCCTCAAGAACCAAGATGAATAGCAATACAATTGCTTCCAAAATGGGTTCCTTCTCCCAATCAGATTCTGTAGCTCTTCACCAAAGGGAACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Anne-France Petit-Bertron et al.
PloS one, 4(8), e6504-e6504 (2009-08-08)
The most recently characterized H4 histamine receptor (H4R) is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 38(3), 204-212 (2018-06-05)
Mast cell (MC) activation through H4R releases various inflammatory mediators which are associated with allergic asthma. To investigate the siRNA-mediated gene silencing effect of H4R on human mast cells (HMCs) functions and the activation of stress-activated protein kinases (SAPK)/jun amino-terminal
Angel Jemima Ebenezer et al.
Journal of receptor and signal transduction research, 37(2), 133-140 (2016-07-13)
The histamine H4 receptor functionally expressed on human mast cells and their signaling pathways for the production of IL-13 and RANTES have never been analyzed side by side in a directly comparable manner. Therefore, the aim of the study was
Ya-Xin Zhao et al.
American journal of physiology. Endocrinology and metabolism, 317(6), E1158-E1171 (2019-09-25)
Although many studies have shown that histamine and its signaling regulate energy homeostasis through the central nervous system, their roles in adipose tissues remain poorly understood. Here, we identified that the histamine H4 receptor (HrH4) was highly expressed in adipocytes

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.