Direkt zum Inhalt
Merck

EHU145401

Sigma-Aldrich

MISSION® esiRNA

targeting human PGAM5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCATCCGCTACATCGTGTGCAGCATCCCGCCGCTGTTGTCCGCTGGGGATTTTGTGCTTCTGGGGTCCTGACCTCTTTCACTTGCTGATCTGTGGGCGCTCCCACCCGTGTGCCAGCGTGACGGCTCGGGGTGTCCGCTCCCCTCTGGGTCGAGGCCACAGCTGAGTCACGTTGCTGCTCGGGCTGCTCCCTCGGGGGGCCCTTGTCCCTCAACCTGCTCTGGTGCCCCACTCTCAGCACCACAGAATGATCCGGGTTCAGGTTGCGTTTTCCCTGCCACCACCCTGCAATCAGCCACTTCTTTAAGGAGCTCCAGGGCTGCAGCCACGTTAGAGGGCCCCTTGGGGGGCAGGGCCAGCTCTACGGTTACATGCCTGAAACAGTCAGAAGGGTTGGCCAAATCTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jeong-Min Hong et al.
Life sciences, 200, 94-104 (2018-03-11)
Heme oxygenase-1 (HO-1), an endogenous cytoprotective enzyme, is reported that can be localized in mitochondria under stress, contributing to preserve mitochondrial function. Mitochondrial quality control (QC) is essential to cellular health and recovery linked with redox homeostasis. Recent studies reported
Wei Zuo et al.
European journal of pharmacology, 880, 173143-173143 (2020-05-04)
Growing evidence have suggested that mitophagy could exert a neuroprotective role in brain ischemia by removing the damaged mitochondria. However the upstream mechanisms of mitophagy are remain unclear. We previously observed a decrease of miR-330 in a miRNA profile of
Chen Yang et al.
In vitro cellular & developmental biology. Animal, 53(3), 248-257 (2016-11-07)
Phosphoglycerate mutase 5 (PGAM5) is a mitochondrial membrane protein that plays crucial roles in necroptosis and apoptosis. Though PGAM5 is known to be required for inducing intrinsic apoptosis through interacting with BCL2 associated X protein (Bax) and dynamin-related protein 1
Yuhua Chen et al.
Antioxidants & redox signaling, 34(2), 154-170 (2020-04-08)
Aims: Traumatic brain injury (TBI) is a major cause of disability and death, and a better understanding of the underlying mechanisms of mitochondrial dysfunction will provide important targets for preventing damage from neuronal insults. Phosphoglycerate mutase 5 (PGAM5) is localized
Wei Lu et al.
Nature communications, 5, 4930-4930 (2014-09-16)
Mitophagy is a specialized form of autophagy that selectively disposes of dysfunctional mitochondria. Delineating the molecular regulation of mitophagy is of great importance because defects in this process lead to a variety of mitochondrial diseases. Here we report that mice

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.