Direkt zum Inhalt
Merck

EHU142651

Sigma-Aldrich

MISSION® esiRNA

targeting human RSAD2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGAGCAATGGAAGCCTGATCCGGGAGAGGTGGTTCCAGAATTATGGTGAGTATTTGGACATTCTCGCTATCTCCTGTGACAGCTTTGACGAGGAAGTCAATGTCCTTATTGGCCGTGGCCAAGGAAAGAAGAACCATGTGGAAAACCTTCAAAAGCTGAGGAGGTGGTGTAGGGATTATAGAGTCGCTTTCAAGATAAATTCTGTCATTAATCGTTTCAACGTGGAAGAGGACATGACGGAACAGATCAAAGCACTAAACCCTGTCCGCTGGAAAGTGTTCCAGTGCCTCTTAATTGAGGGTGAGAATTGTGGAGAAGATGCTCTAAGAGAAGCAGAAAGATTTGTTATTGGTGATGAAGAATTTGAAAGATTCTTGGAGCGCCACAAAGAAGTGTCCTGCTTGGTGCCTGAATCTAACCAGAAGATGAAAGACTCCTACCTTATTCTGGATGAATATATGCGCTTTCTGAACTGTAGAAAGGGACGGAAGGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Leider sind derzeit keine COAs für dieses Produkt online verfügbar.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

B Wang et al.
Placenta, 36(6), 667-673 (2015-03-31)
Viperin, a virus-inducible antiviral protein, has been reported to inhibit the replication of a variety of viruses. However, its expression and function in trophoblast cells remains unclear. Toll-like receptor 3 (TLR3) is a key component of the innate immune system
Keaton M Crosse et al.
Immunology and cell biology, 99(4), 373-391 (2020-11-02)
Viperin is an interferon-inducible protein that is pivotal for eliciting an effective immune response against an array of diverse viral pathogens. Here we describe a mechanism of viperin's broad antiviral activity by demonstrating the protein's ability to synergistically enhance the
Ji-Su Jang et al.
Cell death & disease, 9(8), 823-823 (2018-08-03)
Dendritic cells (DCs) are the most potent professional antigen presenting cells and inducers of T cell-mediated immunity. However, few specific markers of mature DCs (mDC) have been reported. A previous microarray analysis revealed expression of mDC-specific genes and identified Rsad2
José R Peña Cárcamo et al.
Virology, 514, 216-229 (2017-12-05)
Junín arenavirus infections are associated with high levels of interferons in both severe and fatal cases. Upon Junín virus (JUNV) infection a cell signaling cascade initiates, that ultimately attempts to limit viral replication and prevent infection progression through the expression

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.