Direkt zum Inhalt
Merck

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Miguel Ángel Sarabia-Sánchez et al.
Frontiers in oncology, 10, 1039-1039 (2020-08-09)
ALDH is an enzyme involved in different cellular processes, including cancer. It has been shown that a cellular subpopulation with high ALDH activity (ALDHHIGH) within a tumor is related to functional capabilities such as stemness, chemoresistance, and tumorigenicity. However, few
Izabela Janus et al.
Acta veterinaria Hungarica, 64(1), 90-102 (2016-02-27)
Primary heart tumours affect less than 1% of dogs. Due to their rare incidence, every research showing the frequency of cardiac tumours is valuable. Routine diagnostics is often complemented with immunohistochemical analysis. This study was conducted on 110 patient records
Nianchun Hu et al.
Biochemical and biophysical research communications, 533(4), 1457-1463 (2020-12-04)
Oxycodone is a common type of opioid used for the treatment of moderate to severe pain. Besides its analgesic effects on neuron cells, the effects of oxycodone on other cell types are yet to be elucidated. We previously demonstrated that
Bryan E Essien et al.
Cancer research, 76(23), 6877-6887 (2016-10-21)
In colorectal cancer, APC-mediated induction of unregulated cell growth involves posttranslational mechanisms that prevent proteasomal degradation of proto-oncogene β-catenin (CTNNB1) and its eventual translocation to the nucleus. However, about 10% of colorectal tumors also exhibit increased CTNNB1 mRNA. Here, we

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.