Direkt zum Inhalt
Merck

EHU137321

Sigma-Aldrich

MISSION® esiRNA

targeting human TBX21

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGATGTTTGTGGACGTGGTCTTGGTGGACCAGCACCACTGGCGGTACCAGAGCGGCAAGTGGGTGCAGTGTGGAAAGGCCGAGGGCAGCATGCCAGGAAACCGCCTGTACGTCCACCCGGACTCCCCCAACACAGGAGCGCACTGGATGCGCCAGGAAGTTTCATTTGGGAAACTAAAGCTCACAAACAACAAGGGGGCGTCCAACAATGTGACCCAGATGATTGTGCTCCAGTCCCTCCATAAGTACCAGCCCCGGCTGCATATCGTTGAGGTGAACGACGGAGAGCCAGAGGCAGCCTGCAACGCTTCCAACACGCATATCTTTACTTTCCAAGAAACCCAGTTCATTGCCGTGACTGCCTACCAGAATGCCGAGATTACTCAGCTGAAAATTGATAATAACCCCTTTGCCAAAGGATTCCGGGAGAACT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Huiyong Peng et al.
Journal of immunology research, 2020, 6401978-6401978 (2020-05-08)
Long noncoding RNAs (lncRNAs) have been increasingly recognized as key immune molecules that participate in the pathogenesis of autoimmune diseases. Previous studies have demonstrated that the lncRNA Ifng-AS1, a key scaffold that contributes to the transcription of IFN-γ, depends on
Wenjing Yi et al.
Immunology, 150(3), 301-311 (2016-11-04)
Hepatitis C virus (HCV) induces a high rate of chronic infection via dysregulation of host immunity. We have previously shown that T-cell immunoglobulin and mucin domain protein-3 (Tim-3) is up-regulated on monocyte/macrophages (M/Mφ) during chronic HCV infection; little is known
Shigen Hayashi et al.
American journal of respiratory cell and molecular biology, 61(4), 525-536 (2019-04-10)
Chronic obstructive pulmonary disease (COPD) is a progressive lung disease characterized by peripheral airways inflammation and emphysema. Emerging evidence indicates a contribution of both innate and adaptive immune cells to the development of COPD. Transcription factor T-bet modulates the function
Jason S Weinstein et al.
The Journal of experimental medicine, 215(1), 337-355 (2017-12-08)
Follicular helper T (Tfh) cells promote germinal center (GC) B cell survival and proliferation and guide their differentiation and immunoglobulin isotype switching by delivering contact-dependent and soluble factors, including IL-21, IL-4, IL-9, and IFN-γ. IL-21 and IFN-γ are coexpressed by

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.