Direkt zum Inhalt
Merck

EHU134461

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGGTTCCGGTGTTCAACATTGTCATTCTCCTGGCTGGTGGATTCCTGAGTAAGAGCCTGGTCTTCTCTGTCCTGTTTGCTGTCACGCTGAGGTCATTTGTACCCTAGGCCCACGAACCCACGAGAATGTCCTCTGACTTCCAGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaoliang Zhang et al.
PloS one, 14(9), e0221991-e0221991 (2019-09-12)
This study aimed to examine the macrophage phenotype and its relationship to renal function and histological changes in human DN and the effect of TREM-1 on high-glucose-induced macrophage activation. We observed that in renal tissue biopsies, the expression of CD68
Mansoor Ali Syed et al.
American journal of respiratory cell and molecular biology, 60(3), 308-322 (2018-10-04)
Hyperoxia-induced injury to the developing lung, impaired alveolarization, and dysregulated vascularization are critical factors in the pathogenesis of bronchopulmonary dysplasia (BPD); however, mechanisms for hyperoxia-induced development of BPD are not fully known. In this study, we show that TREM-1 (triggering
Danping Fan et al.
International journal of molecular sciences, 17(4), 498-498 (2016-04-07)
Triptolide (TP), an active component isolated from Tripterygiumwilfordii Hook F, has therapeutic potential against rheumatoid arthritis (RA). However, the underlying molecular mechanism has not been fully elucidated. The aim of this study is to investigate the mechanisms of TP acting
Jianfei Tang et al.
Biochemical and biophysical research communications, 482(4), 1240-1245 (2016-12-10)
Triggering receptor expressed on myeloid cells 1 (TREM-1) is a recently discovered molecule that modulates inflammatory responses. This study aimed to investigate the specific function of TREM-1 in chondrocytes and its association with the pathophysiology of osteoarthritis (OA). We observed

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.