Direkt zum Inhalt
Merck

EHU133721

Sigma-Aldrich

MISSION® esiRNA

targeting human CASC2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGCAGATGGAGATTCAGAAACATAAGGACAACAAGAAACTTCCCCAAGGTATCATTATAGTCTTTAGACTTCAGACACACACCACACCTCAAATATATACACAACTGAAAGGAAAATTAAGGAAGTTTTTCAAAGAACCCTATTCCGAGTAAGAAGTGTGTTGCATGAATTTCTAAGAGCCAGAAAATGCATGACACAGGAGAAGATGTACCCTCATCTGTTCAGTGAGAGATGTGCAAATCAACATCAACACAGAACTGCTGAAGAAAAAAAATATGTCTCTGAAAAGCAACTTATTCACTGGAGATGTGAGGAGCCATCCGCACATCACAATTCTATAGACATCAAACGCATGAAGCATTTCGGATCTGCTTTAAGACTGAGGCAGACTTTCCATCTGGACACAGCCGACCATCCATGTGTCATTACAATGAATCCAGCACTTCCCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CASC2(255082)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Y X Dai et al.
Journal of biological regulators and homeostatic agents, 34(1), 49-56 (2020-03-07)
Dysregulation of lncRNA cancer susceptibility candidate 2 (CASC2) is involved in the pathogenesis of multiple malignancies. However, the underlying mechanisms by which lncRNA CASC2 regulates the proliferation of hemangiomas (HAs) remain undocumented. Herein, the expression levels of lncRNA CASC2 and
Yufeng Wang et al.
Molecular cancer, 16(1), 123-123 (2017-07-19)
Recently, it has been reported that long non-coding RNA (lncRNA) cancer susceptibility candidate 2 (CASC2), a novel tumor suppressor, participates in regulating the carcinogenesis and suppresses tumor progression by sponging microRNAs (miRNAs). However, the expression and function of CASC2 in
Chenjing Wang et al.
Molecular medicine (Cambridge, Mass.), 26(1), 74-74 (2020-07-24)
Studies have demonstrated that long noncoding RNAs (lncRNAs) have essential impacts on the development of atherosclerosis (AS). This study aimed to identify the role and functional mechanism of lncRNA CASC2 in the development and migration of vascular smooth muscle cells
Qi-Yu Liu et al.
The Kaohsiung journal of medical sciences, 37(4), 268-275 (2020-12-19)
Long noncoding RNA (lncRNA) Cancer Susceptibility 2 (CASC2) has been proved to contribute to the development of cancers. However, the mechanism behind the action of CASC2 in thyroid cancer is not quite clear. We demonstrated that CASC2 was downregulated in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.