Direkt zum Inhalt
Merck

EHU133481

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM173

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATATCTGCGGCTGATCCTGCCAGAGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAACAACCTGCTACGGGGTGCAGTGAGCCAGCGGCTGTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACCTGAGTATGGCTGACCCCAACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATCAAGGATCGGGTTTACAGCAACAGCATCTATGAGCTTCTGGAGAACGGGCAGCGGGCGGGCACCTGTGTCCTGGAGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAATACAGTCAAGCTGGCTTTAGCCGGGAGGATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCTACCAGGAACC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Li Zhou et al.
Cancer letters, 500, 163-171 (2020-12-06)
Although the combination of chemotherapy and immunotherapy is a hot topic in lung cancer, little is understood regarding the possible mechanisms behind their synergy. Moreover, safety is a major concern for clinicians while performing chemotherapy. Therefore, it is important to
Junxia Cui et al.
Fish & shellfish immunology, 68, 29-36 (2017-07-08)
In the innate immune responses in host protection, pattern recognition receptors are involve in a variety of sensing mechanisms to recognize and counter pathogen invasion. Recently, a resident endoplasmic reticulum adaptor, stimulator of interferon genes (STING) protein, also called MPYS
Jin-Shan Ran et al.
International journal of molecular sciences, 19(12) (2018-11-25)
Innate immunity is an essential line of defense against pathogen invasion which is gained at birth, and the mechanism involved is mainly to identify pathogen-associated molecular patterns through pattern recognition receptors. STING (stimulator of interferon genes) is a signal junction
Marcin Gamdzyk et al.
Molecular neurobiology, 57(6), 2600-2619 (2020-04-08)
cGAS is a sensor of cytosolic DNA and responds equally to exogenous and endogenous DNA. After recognition of cytosolic dsDNA or ssDNA, cGAS synthesizes the second messenger 2'3'-cGAMP, which then binds to and activates stimulator of interferon genes (STING). STING
Yin Wu et al.
Biochemical and biophysical research communications, 546, 138-144 (2021-02-15)
Hepatic injury is common in patients who suffer from severe burns plus delayed resuscitation (B + DR). Stimulator of interferon genes (STING) is primarily expressed in Kupffer cells (KCs). We demonstrated that B + DR caused hepatic injury and oxidative stress. Reactive oxygen species

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.