Direkt zum Inhalt
Merck

EHU132681

Sigma-Aldrich

MISSION® esiRNA

targeting human IFI16

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGCTCCACCCAACAGTTCTTCAACTGAGAACCCGAAAACAGTGGCCAAATGTCAGGTAACTCCCAGAAGAAATGTTCTCCAAAAACGCCCAGTGATAGTGAAGGTACTGAGTACAACAAAGCCATTTGAATATGAGACCCCAGAAATGGAGAAAAAAATAATGTTTCATGCTACAGTGGCTACACAGACACAGTTCTTCCATGTGAAGGTTTTAAACACCAGCTTGAAGGAGAAATTCAATGGAAAGAAAATCATCATCATATCAGATTATTTGGAATATGATAGTCTCCTAGAGGTCAATGAAGAATCTACTGTATCTGAAGCTGGTCCTAACCAAACGTTTGAGGTTCCAAATAAAATCATCAACAGAGCAAAGGAAACTCTGAAGATTGATATTCTTCACAAACAAGCTTCAGGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Cindy Orvain et al.
The Journal of clinical investigation, 130(7), 3777-3790 (2020-04-03)
Hidradenitis suppurativa (HS) is a chronic, relapsing, inflammatory skin disease. HS appears to be a primary abnormality in the pilosebaceous-apocrine unit. In this work, we characterized hair follicle stem cells (HFSCs) isolated from HS patients and more precisely the outer
A Berry et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 24(6), 1700-1713 (2010-01-21)
Previously, we used cDNA expression profiling to identify genes associated with glucocorticoid (Gc) sensitivity. We now identify which of these directly influence Gc action. Interferon-inducible protein 16 (IFI16), bone morphogenetic protein receptor type II (BMPRII), and regulator of G-protein signaling
Stine Søby et al.
Herpesviridae, 3(1), 6-6 (2012-10-16)
Innate recognition is essential in the antiviral response against infection by herpes simplex virus (HSV). Chemokines are important for control of HSV via recruitment of natural killer cells, T lymphocytes, and antigen-presenting cells. We previously found that early HSV-1-mediated chemokine
Yuanyuan Yang et al.
Hepatology (Baltimore, Md.), 71(4), 1154-1169 (2019-08-14)
Nuclear-located covalently closed circular DNA (cccDNA) of hepatitis B virus (HBV) is a determining factor for HBV persistence and the key obstacle for a cure of chronic hepatitis B. However, it remains unclear whether and how the host immune system
Xin Duan et al.
PloS one, 6(5), e19532-e19532 (2011-05-17)
Glucose restriction in cells increases the AMP/ATP ratio (energetic stress), which activates the AMPK/p53 pathway. Depending upon the energetic stress levels, cells undergo either autophagy or cell death. Given that the activated p53 induces the expression of IFI16 protein, we

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.