Direkt zum Inhalt
Merck

EHU132491

Sigma-Aldrich

MISSION® esiRNA

targeting human BTK

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Voraussichtliches Versanddatum03. April 2025



Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Voraussichtliches Versanddatum03. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGCCATCAAGATGATCAAAGAAGGCTCCATGTCTGAAGATGAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAGCAGCGCCCCATCTTCATCATCACTGAGTACATGGCCAATGGCTGCCTCCTGAACTACCTGAGGGAGATGCGCCACCGCTTCCAGACTCAGCAGCTGCTAGAGATGTGCAAGGATGTCTGTGAAGCCATGGAATACCTGGAGTCAAAGCAGTTCCTTCACCGAGACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTTAAAGTATCTGATTTCGGCCTGTCCAGGTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCAGTCCGGTGGTCCCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATTTGGGCTTTTGGGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGATTTACTAACAGTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCATCTGGCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... BTK(695) , BTK(695)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

E Slinger et al.
Leukemia, 31(12), 2601-2607 (2017-05-04)
The clinical success of B-cell receptor (BCR) signaling pathway inhibitors in chronic lymphocytic leukemia (CLL) is attributed to inhibition of adhesion in and migration towards the lymph node. Proliferation of CLL cells is restricted to this protective niche, but the
Chandra Bose Prabaharan et al.
Investigational new drugs, 38(4), 909-921 (2019-08-04)
Treatment response rates to current anticancer therapies for HER2 overexpressing breast cancer are limited and are associated with severe adverse drug reactions. Tyrosine kinases perform crucial roles in cellular processes by mediating cell signalling cascades. Ibrutinib is a recently approved Tyrosine Kinase
Agnieszka Krupa et al.
American journal of physiology. Lung cellular and molecular physiology, 307(6), L435-L448 (2014-08-03)
Previous observations made by our laboratory indicate that Bruton's tyrosine kinase (Btk) may play an important role in the pathophysiology of local inflammation in acute lung injury (ALI)/acute respiratory distress syndrome (ARDS). We have shown that there is cross talk
Genevra Pillinger et al.
Scientific reports, 5, 12949-12949 (2015-08-22)
Approximately 20% of patients with acute myeloid leukaemia (AML) have a mutation in FMS-like-tyrosine-kinase-3 (FLT3). FLT3 is a trans-membrane receptor with a tyrosine kinase domain which, when activated, initiates a cascade of phosphorylated proteins including the SRC family of kinases.
Angela Marina Montalbano et al.
European journal of pharmacology, 736, 35-43 (2014-05-07)
Cigarette smoke extract (CSE) affects the expression of Choline Acetyl-Transferase (ChAT), muscarinic acetylcholine receptors, and mucin production in bronchial epithelial cells. Mucin 5AC (MUC5AC), muscarinic acetylcholine receptor M3, ChAT expression, acetylcholine levels and acetylcholine binding were measured in a human

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.