Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU130891

Sigma-Aldrich

MISSION® esiRNA

targeting human TUG1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA

Ensembl | Human Hinterlegungsnummer

ENSG00000182457

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TUG1(55000)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

T Xu et al.
European review for medical and pharmacological sciences, 23(11), 4698-4705 (2019-06-19)
To explore the correlation between plasma level of lncRNA TUG1 with PSA level, Gleason grading and tumor node metastasis (TNM) stage of prostate cancer (PCa) patients. This study aims to evaluate the potential diagnostic and prognostic values of TUG1 in
Yanqian Wang et al.
International journal of oncology, 54(4), 1317-1326 (2019-02-06)
Melanoma is an aggressive type of skin cancer, characterized by high mortality rates worldwide. Therefore, the identification of new diagnostic markers and therapeutic targets for melanoma is imperative. Accumulating evidence has demonstrated that long non-coding RNAs (lncRNAs) play important roles
Pan Wang et al.
Journal of experimental & clinical cancer research : CR, 39(1), 7-7 (2020-01-11)
Long noncoding RNAs (lncRNAs) are involved in the progression of various cancers and affect the response to radiotherapy. This study focused on clarifying the underlying mechanism by which lncTUG1 affects the radiosensitivity of esophageal squamous cell carcinoma (ESCC). lncTUG1, miR-144-3p
Dong Lv et al.
OncoTargets and therapy, 13, 5857-5868 (2020-07-02)
Clear cell renal cell carcinoma (ccRCC) is a common urological carcinoma in adults. Long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) has been reported to be involved in the progression of diverse human cancers, including renal cell carcinoma (RCC). However
Xiaodi Liu et al.
Journal of cellular biochemistry (2019-03-06)
This study intended to investigate the potential molecular mechanism of long noncoding RNA (lncRNA) taurine upregulated gene 1 (TUG1) in the development of sepsis-associated acute kidney injury (AKI). The expression of TUG1 in the serum from patients with sepsis resulted
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.