Direkt zum Inhalt
Merck

EHU120531

Sigma-Aldrich

MISSION® esiRNA

targeting human USP22

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAACTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAACACTCAGCCAAGCTGCGGCGGAAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCCAGCAAAGAGAGCAGGATGAATGGACAGTACCAGCAGCCCACGGACAGTCTCAACAATGACAACAAGTATTCCCTGTTTGCTGTTGTTAACCATCAAGGGACCTTGGAGAGTGGCCACTACACCAGCTTTATCCGGCAGCACAAAGACCAGTGGTTCAAGTGTGACGATGCCATCATCACCAAGGCCAGCATCAAGGACGTCCTGGACAGCGAAGGGTACTTGCTGTTCTATCACAAACAGTTCCTGGAATACGAGTAGCCTTATCTGCAGCTGGTCAGAAAAACAAAGGCAATGCATTGGCAAGCCTCACAAAGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dongyeon Kim et al.
Journal of cellular physiology, 232(12), 3664-3676 (2017-02-06)
The proto-oncogene c-Myc has a pivotal function in growth control, differentiation, and apoptosis and is frequently affected in human cancer, including breast cancer. Ubiquitin-specific protease 22 (USP22), a member of the USP family of deubiquitinating enzymes (DUBs), mediates deubiquitination of
Gaojun Xu et al.
Experimental cell research, 362(2), 268-278 (2017-11-28)
MicroRNA-30e-5p (miR-30e-5p) is a tumor suppressor that is known to be downregulated in non-small cell lung cancer (NSCLC). However, how miR-30e-5p inhibits NSCLC tumorigenesis is not known. Ubiquitin-specific peptidase 22 (USP22) is upregulated in NSCLC and promotes tumorigenesis via a
An-Long Ji et al.
World journal of gastroenterology, 25(7), 824-836 (2019-02-28)
Intestinal ischemia reperfusion (I/R) injury is a serious but common pathophysiological process of many diseases, resulting in a high mortality rate in clinical practice. Ubiquitin-specific protease 22 (USP22) acts as regulator of cell cycle progression, proliferation, and tumor invasion. Depleted
Ying Lin et al.
Oncology letters, 20(5), 246-246 (2020-09-26)
Renal cell carcinoma (RCC) is one of the commonest urological tumors. The incidence of RCC ranks third among urological tumors, after prostate cancer and bladder tumors. However, the etiology of RCC remains unclear. Ubiquitin-specific protease 22 (USP22), a potential marker
R-Q Xin et al.
European review for medical and pharmacological sciences, 24(19), 9932-9939 (2020-10-23)
MicroRNA-329-3p (miR-329-3p) has been shown to be involved in tumor development. But its role in hepatocellular carcinoma has not been explored. Our study aims to explore the effect and mechanism of miR-329-3p on hepatocellular carcinoma development. Hepatocellular carcinoma tissues and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.