Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU117241

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC42

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA

Ensembl | Human Hinterlegungsnummer

ENSG00000070831

NCBI-Hinterlegungsnummer

NM_001791

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CDC42(998) , CDC42(998)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Huanxin Ma et al.
Frontiers in oncology, 10, 438-438 (2020-05-01)
PIWI-interacting RNA (piRNA) is a kind of non-coding single stranded RNA which plays major roles in epigenetic expressions, genome rearrangement, and regulation of gene and protein. Because piRNAs are abnormally expressed in various cancers, they can be used as novel
Arjun P Athreya et al.
Oncotarget, 8(16), 27199-27215 (2017-04-21)
We demonstrate that model-based unsupervised learning can uniquely discriminate single-cell subpopulations by their gene expression distributions, which in turn allow us to identify specific genes for focused functional studies. This method was applied to MDA-MB-231 breast cancer cells treated with
Xiaolei Liu et al.
Development (Cambridge, England), 145(17) (2018-07-26)
Although major progress in our understanding of the genes and mechanisms that regulate lymphatic vasculature development has been made, we still do not know how lumen formation and maintenance occurs. Here, we identify the Ras-interacting protein Rasip1 as a key
Shayoni Ray et al.
Molecular biology of the cell, 25(16), 2393-2407 (2014-06-27)
Coordinated actin microfilament and microtubule dynamics is required for salivary gland development, although the mechanisms by which they contribute to branching morphogenesis are not defined. Because LIM kinase (LIMK) regulates both actin and microtubule organization, we investigated the role of
Tilman D Rachner et al.
Breast cancer research : BCR, 16(1), R20-R20 (2014-02-18)
Amino-bisphosphonates and statins inhibit the mevalonate pathway, and may exert anti-tumor effects. The Wnt inhibitor dickkopf-1 (DKK-1) promotes osteolytic bone lesions by inhibiting osteoblast functions and has been implicated as an adverse marker in multiple cancers. We assessed the effects

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.