Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU116291

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGTGCTCAGAGGTTCCACATCAACCTGTGCTCTGGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAACACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTCGTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCCGTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAACAGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAGGCGGCTTCCTGGCCCTGGGGCCGGGGGCTGGGGTGTGGGGCAGTCTGGGTCCTCTCATCATCC

Ensembl | Human Hinterlegungsnummer

ENSG00000168961

NCBI-Hinterlegungsnummer

NM_002308

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LGALS9(3965) , LGALS9(3965)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Katrin Schaefer et al.
Glycobiology, 27(9), 878-887 (2017-08-16)
Changes in the T cell surface redox environment regulate critical cell functions, such as cell migration, viral entry and cytokine production. Cell surface protein disulfide isomerase (PDI) contributes to the regulation of T cell surface redox status. Cell surface PDI
Tomokazu Nunoue et al.
Scientific reports, 11(1), 5991-5991 (2021-03-18)
The adipose tissue is regarded as an endocrine organ and secretes bioactive adipokines modulating chronic inflammation and oxidative stress in obesity. Gal-9 is secreted out upon cell injuries, interacts with T-cell immunoglobulin-3 (Tim-3) and induces apoptosis in activated Th1 cells.
Akira Nishio et al.
Hepatology (Baltimore, Md.), 65(1), 18-31 (2016-09-20)
Natural killer (NK) cell activation is associated with both liver injury and persistent infection in chronic hepatitis C (CHC); however, the detailed mechanism of this activation has not yet been fully elucidated. Because galectin-9 (Gal-9) has been reported to be
Wenxi Zhou et al.
Biomaterials, 268, 120546-120546 (2020-12-01)
Immunotherapy has gained increasing focus in treating pancreatic ductal adenocarcinoma (PDAC), since conventional therapies like chemotherapy could not provide satisfactory improvement in overall survival outcome of PDAC patients. However, it is still not the game changing solution due to the
Ran Lv et al.
Molecular medicine reports, 16(6), 9111-9119 (2017-10-11)
Generally considered as a potent pro‑inflammatory signal, β‑galactosidelectin suppresses T cell receptor activation, can both promote and inhibit integrin‑mediated adhesion and is required in nuclear pre‑mRNA splicing. Galectin‑9 (Gal‑9), a member of β‑galactoside lectin, is involved many processes of T cell‑mediated
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.