Direkt zum Inhalt
Merck

EHU112941

Sigma-Aldrich

MISSION® esiRNA

targeting human ATRX

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAAGGAAGAAGTGGGCTGAAGAATTTAATGATGAAACTAATGTGAGAGGACGATTATTTATCATTTCTACTAAAGCAGGATCTCTAGGAATTAATCTGGTAGCTGCTAATCGAGTAATTATATTCGACGCTTCTTGGAATCCATCTTATGACATCCAGAGTATATTCAGAGTTTATCGCTTTGGACAAACTAAGCCTGTTTATGTATATAGGTTCTTAGCTCAGGGAACCATGGAAGATAAGATTTATGATCGGCAAGTAACTAAGCAGTCACTGTCTTTTCGAGTTGTTGATCAGCAGCAGGTGGAGCGTCATTTTACTATGAATGAGCTTACTGAACTTTATACTTTTGAGCCAGACTTATTAGATGACCCTAATTCAGAAAAGAAGAAGAAGAGGGATACTCCCATGCTGCCAAAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jaewon Min et al.
Nucleic acids research, 45(5), 2615-2628 (2017-01-14)
Alternative lengthening of telomeres (ALT) is a telomerase independent telomere maintenance mechanism that occurs in ∼15% of cancers. The potential mechanism of ALT is homology-directed telomere synthesis, but molecular mechanisms of how ALT maintains telomere length in human cancer is
Manav Pathania et al.
Cancer cell, 32(5), 684-700 (2017-11-07)
Gain-of-function mutations in histone 3 (H3) variants are found in a substantial proportion of pediatric high-grade gliomas (pHGG), often in association with TP53 loss and platelet-derived growth factor receptor alpha (PDGFRA) amplification. Here, we describe a somatic mouse model wherein
Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can
Jinquan Cai et al.
Oncotarget, 6(20), 18105-18115 (2015-05-15)
Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.