Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU108531

Sigma-Aldrich

MISSION® esiRNA

targeting human LDHA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGTCAGCAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAACGTGAACATCTTTAAATTCATCATTCCTAATGTTGTAAAATACAGCCCGAACTGCAAGTTGCTTATTGTTTCAAATCCAGTGGATATCTTGACCTACGTGGCTTGGAAGATAAGTGGTTTTCCCAAAAACCGTGTTATTGGAAGCGGTTGCAATCTGGATTCAGCCCGATTCCGTTACCTAATGGGGGAAAGGCTGGGAGTTCACCCATTAAGCTGTCATGGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTGCCTGTATGGAGTGGAATGAATGTTGCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACTGATAAAGATAAGGAACAGTGGAAAGAGGTTCACAAGCAGGTGGTTGAG

Ensembl | Human Hinterlegungsnummer

ENSG00000134333

NCBI-Hinterlegungsnummer

NM_005566

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LDHA(3939) , LDHA(3939)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Weiyou Zhu et al.
American journal of translational research, 10(7), 2055-2067 (2018-08-11)
The use of human epidermal growth factor receptor-2 (HER2) as a biomarker for gastric cancer (GC) has greatly helped some patients receive benefit from HER2-targeted therapy. However, the correlation between HER2 and other biochemical markers is unclear. The aim of
Michael Koukourakis et al.
Biochemical and biophysical research communications, 491(4), 932-938 (2017-08-02)
Up-regulation of lactate dehydrogenase LDHA, is a frequent event in human malignancies and relate to poor postoperative outcome. In the current study we examined the hypothesis that LDHA and anaerobic glycolysis, may contribute to the resistance of glioblastoma to radiotherapy
Michael I Koukourakis et al.
Laboratory investigation; a journal of technical methods and pathology, 97(11), 1321-1331 (2017-08-29)
Cooperation of cancer cells with stromal cells, such as cancer-associated fibroblasts (CAFs), has been revealed as a mechanism sustaining cancer cell survival and growth. In the current study, we focus on the metabolic interactions of MRC5 lung fibroblasts with lung
Yong-Jin Kwon et al.
Cells, 9(4) (2020-04-23)
Circadian oscillation is an essential process that influences many physiological and biological mechanisms and a decrease of circadian genes is associated with many diseases such as cancer. Despite many efforts to identify the detailed mechanism for decreasing circadian genes and
L Jin et al.
Oncogene, 36(27), 3797-3806 (2017-02-22)
Metastases remain the major cause of death from cancer. Recent molecular advances have highlighted the importance of metabolic alterations in cancer cells, including the Warburg effect that describes an increased glycolysis in cancer cells. However, how this altered metabolism contributes
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.