Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU106951

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1B1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCGACCTGAAGCTGGACTACCTGGACCTCTACCTTATTCACTGGCCGACTGGCTTTAAGCCTGGGAAGGAATTTTTCCCATTGGATGAGTCGGGCAATGTGGTTCCCAGTGACACCAACATTCTGGACACGTGGGCGGCCATGGAAGAGCTGGTGGATGAAGGGCTGGTGAAAGCTATTGGCATCTCCAACTTCAACCATCTCCAGGTGGAGATGATCTTAAACAAACCTGGCTTGAAGTATAAGCCTGCAGTTAACCAGATTGAGTGCCACCCATATCTCACTCAGGAGAAGTTAATCCAGTACTGCCAGTCCAAAGGCATCGTGGTGACCGCCTACAGCCCCCTCGGCTCTCCTGACAGGCCCTGGGCCAAGCCCGAGGACCCTTCTCTCCTGGAGGATCCCAGGATCAAGGCGATCGCAGCCAAGCACAATAAAACTACAGCCCAGGTCCTGATCCGGTTCCCCATGCAGAGGAACTTGGTGGTGATCCCCAAGTCTGTGACA

Ensembl | Human Hinterlegungsnummer

ENSG00000085662

NCBI-Hinterlegungsnummer

NM_001628

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... AKR1B1(231) , AKR1B1(231)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xuebiao Wu et al.
The Journal of experimental medicine, 214(4), 1065-1079 (2017-03-09)
Basal-like breast cancer (BLBC) is associated with high-grade, distant metastasis and poor prognosis. Elucidating the determinants of aggressiveness in BLBC may facilitate the development of novel interventions for this challenging disease. In this study, we show that aldo-keto reductase 1
Boel De Paepe et al.
Frontiers in neurology, 9, 846-846 (2018-10-27)
We recently identified osmolyte accumulators as novel biomarkers for chronic skeletal muscle inflammation and weakness, but their precise involvement in inflammatory myopathies remains elusive. In the current study, we demonstrate in vitro that, in myoblasts and myotubes exposed to pro-inflammatory
Pabitra B Pal et al.
Endocrinology, 158(10), 3661-3675 (2017-09-25)
Despite recent studies that show oxidative stress-generated reactive oxygen species (ROS) regulate NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome-mediated innate immune response in various diabetic complications, the mechanism by which ROS activate innate immune response is not well
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.