Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU100781

Sigma-Aldrich

MISSION® esiRNA

targeting human SREBF2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCGCTCCTCCATCAATGACAAAATCATCGAATTGAAAGACCTGGTCATGGGGACAGACGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATACTTGCAGCAGGTCAATCATAAACTGCGCCAGGAGAACATGGTGCTGAAGCTGGCAAATCAAAAGAACAAGCTTCTAAAGGGCATCGACCTAGGCAGTCTGGTGGACAATGAGGTGGACCT

Ensembl | Human Hinterlegungsnummer

ENSG00000198911

NCBI-Hinterlegungsnummer

NM_004599

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SREBF2(6721) , SREBF2(6721)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Demin Cai et al.
Nature communications, 10(1), 4621-4621 (2019-10-13)
Tumor subtype-specific metabolic reprogrammers could serve as targets of therapeutic intervention. Here we show that triple-negative breast cancer (TNBC) exhibits a hyper-activated cholesterol-biosynthesis program that is strongly linked to nuclear receptor RORγ, compared to estrogen receptor-positive breast cancer. Genetic and
Johan Fernø et al.
BMC neuroscience, 7, 69-69 (2006-10-21)
The etiology of schizophrenia is unknown, but neurodevelopmental disturbances, myelin- and oligodendrocyte abnormalities and synaptic dysfunction have been suggested as pathophysiological factors in this severe psychiatric disorder. Cholesterol is an essential component of myelin and has proved important for synapse
Silvia Cetrullo et al.
Cells, 9(3) (2020-03-01)
While high levels of saturated fatty acids are associated with impairment of cardiovascular functions, n-3 polyunsaturated fatty acids (PUFAs) have been shown to exert protective effects. However the molecular mechanisms underlying this evidence are not completely understood. In the present
Paul Lebeau et al.
The Journal of biological chemistry, 292(4), 1510-1523 (2016-12-03)
Accumulating evidence implicates endoplasmic reticulum (ER) stress as a mediator of impaired lipid metabolism, thereby contributing to fatty liver disease and atherosclerosis. Previous studies demonstrated that ER stress can activate the sterol regulatory element-binding protein-2 (SREBP2), an ER-localized transcription factor
Qingrong Li et al.
The Journal of toxicological sciences, 44(7), 481-491 (2019-07-05)
Bisphenol A (BPA), an environmental chemical to which humans are commonly exposed, has been shown to increase cholesterol level but the molecular mechanism is not clear. Since cholesterol biosynthesis plays an important role in elevating cholesterol level, the aim of
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.