Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU093481

Sigma-Aldrich

MISSION® esiRNA

targeting human CFLAR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA

Ensembl | Human Hinterlegungsnummer

ENSG00000003402

NCBI-Hinterlegungsnummer

NM_003879

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CFLAR(8837) , CFLAR(8837)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

H H Cheung et al.
Cell death & disease, 2, e146-e146 (2011-04-15)
Smac mimetic compounds (SMCs) are experimental small molecules that induce tumour necrosis factor alpha (TNFα)-dependent cancer cell death by targeting the inhibitor of apoptosis proteins. However, many cancer cell lines are resistant to SMC-mediated apoptosis despite the presence of TNFα.
Reyaz ur Rasool et al.
Scientific reports, 6, 18800-18800 (2016-01-06)
The eukaryotic translation initiation factor 4E (eIF4E) is considered as a key survival protein involved in cell cycle progression, transformation and apoptosis resistance. Herein, we demonstrate that medicinal plant derivative 3-AWA (from Withaferin A) suppressed the proliferation and metastasis of
Therese Bredholt et al.
Molecular cancer, 8, 101-101 (2009-11-17)
An organic extract of the recreational herb khat (Catha edulis Forsk.) triggers cell death in various leukemia cell lines in vitro. The chemotherapeutics camptothecin, a plant alkaloid topoisomerase I inhibitor, was tested side-by-side with khat in a panel of acute
Andre van Krüchten et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(5), 2779-2793 (2018-02-07)
Superinfections with Staphylococcus aureus are a major complication of influenza disease, causing excessive inflammation and tissue damage. This enhanced cell-damaging effect is also observed in superinfected tissue cultures, leading to a strong decrease in overall cell viability. In our analysis
Yao Wang et al.
Frontiers in oncology, 9, 857-857 (2019-09-26)
Immune checkpoint blockade of programmed cell death protein 1 (PD-1) had an impressive long-lasting effect in a portion of advanced-stage melanoma patients, however, this therapy failed to induce responses in several patients; how to increase the objective response rate is
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.