Direkt zum Inhalt
Merck

EHU092661

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT8

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCTCTGCAAACTTCCATTCTTTAGATGACATCTACTATTTTGGGGGCCAGAATGCCCACAATCAAATTGCCATTTATGCTCACCAACCCCGAACTGCAGATGAAATTCCCATGGAACCTGGAGATATCATTGGTGTGGCTGGAAATCATTGGGATGGCTATTCTAAAGGTGTCAACAGGAAATTGGGAAGGACGGGCCTATATCCCTCCTACAAAGTTCGAGAGAAGATAGAAACGGTCAAGTACCCCACATATCCTGAGGCTGAGAAATAAAGCTCAGATGGAAGAGATAAACGACCAAACTCAGTTCGACCAAACTCAGTTCAAACCATTTCAGCCAAACTGTAGATGAAGAGGGCTCTGATCTAACAAAATAAGGTTATATGAGTAGATACTCTCAGCACCAAGAGCAGCTGGGAACTGAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ming Yu et al.
Placenta, 75, 45-53 (2019-02-05)
Trophoblast proliferation and invasion are essential for embryo implantation and placentation. Protein glycosylation is one of the most common and vital post-translational modifications, regulates protein physical and biochemical properties. FUT8 is the only known fucosyltransferase responsible for catalyzing α1,6-fucosylation in
Kazuhiro Tada et al.
Surgery today, 50(7), 767-777 (2020-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer. It is an aggressive malignancy associated with poor prognosis because of recurrence, metastasis, and treatment resistance. Aberrant glycosylation of cancer cells triggers their migration and invasion and is
Shu Li et al.
Viruses, 11(4) (2019-04-27)
Hepatitis C virus (HCV) is a major cause of human chronic liver disease and hepatocellular carcinoma. Our recent studies showed that α1,6-fucosyltransferase (FUT8), a key glycosyltransferase, was the most up-regulated glycosyltransferase after the HCV infection of human hepatocellular carcinoma Huh7.5.1
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the
Li Shen et al.
Cellular oncology (Dordrecht), 43(4), 695-707 (2020-06-01)
Radio-resistance is recognized as a main factor in the failure of radiotherapy in oesophageal squamous cell carcinoma (ESCC). Aberrant cell surface glycosylation has been reported to correlate with radio-resistance in different kinds of tumours. However, glycomic alterations and the corresponding

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.