Direkt zum Inhalt
Merck

EHU088861

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGA6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Voraussichtliches Versanddatum04. Mai 2025



Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Voraussichtliches Versanddatum04. Mai 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCCTCTTCATTTGGCTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGGCAAGATATAGTTATTGGAGCCCCACAGTATTTTGATAGAGATGGAGAAGTTGGAGGTGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATAATGTGAAGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGCATTGCAGTAAAAAATATTGGAGATATTAATCAAGATGGCTACCCAGATATTGCAGTTGGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chunbo He et al.
Cell reports, 26(10), 2636-2650 (2019-03-07)
HPV infections are common in healthy women and only rarely cause cervical cancer, suggesting that individual genetic susceptibility may play a critical role in the establishment of persistent HPV infection and the development of cervical cancer. Here, we provide convincing in vitro
Daiane Cristina F Golbert et al.
Cell adhesion & migration, 12(2), 152-167 (2017-05-12)
The thymus supports differentiation of T cell precursors. This process requires relocation of developing thymocytes throughout multiple microenvironments of the organ, mainly with thymic epithelial cells (TEC), which control intrathymic T cell differentiation influencing the formation and maintenance of the
Nan Liu et al.
Nature, 568(7752), 344-350 (2019-04-05)
Stem cells underlie tissue homeostasis, but their dynamics during ageing-and the relevance of these dynamics to organ ageing-remain unknown. Here we report that the expression of the hemidesmosome component collagen XVII (COL17A1) by epidermal stem cells fluctuates physiologically through genomic/oxidative
Miyeon Kim et al.
Stem cells international, 2020, 5924983-5924983 (2020-05-14)
Mesenchymal stem cells (MSCs) represent a promising means to promote tissue regeneration. However, the heterogeneity of MSCs impedes their use for regenerative medicine. Further investigation of this phenotype is required to develop cell therapies with improved clinical efficacy. Here, a
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.