Direkt zum Inhalt
Merck

EHU083931

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB16

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCACCCCTACGAGTGTGAGTTCTGTGGCAGCTGCTTCCGGGATGAGAGCACACTCAAGAGCCACAAACGCATCCACACGGGTGAGAAACCCTACGAGTGCAATGGCTGTGGCAAGAAGTTCAGCCTCAAGCATCAGCTGGAGACGCACTATAGGGTGCACACAGGTGAGAAGCCCTTTGAGTGTAAGCTCTGCCACCAGCGCTCCCGGGACTACTCGGCCATGATCAAGCACCTGAGAACGCACAACGGCGCCTCGCCCTACCAGTGCACCATCTGCACAGAGTACTGCCCCAGCCTCTCCTCCATGCAGAAGCACATGAAGGGCCACAAGCCCGAGGAGATCCCGCCCGACTGGAGGATAGAGAAGACGTACCTCTACCTGTGCTATGTGTGAAGGGAGGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wencong Song et al.
Journal of cellular biochemistry, 116(10), 2155-2165 (2015-03-27)
The balance between the self-renewal and differentiation of male germline stem cells (mGSCs) is critical for the initiation and maintenance of mammalian spermatogenesis. The promyelocytic leukemia zinc finger (PLZF), a zinc finger protein, is a critical factor for maintaining the
Wencheng Kong et al.
Aging, 12(23), 24009-24022 (2020-11-23)
Peritoneal metastasis (PM) is the main cause of poor prognosis in patients with advanced gastric cancer (GC). Increasing evidence has suggested that cancer-associated EVs in body fluids may assist in the diagnosis and treatment of GC. Here, we investigated the
Yung-Ho Hsu et al.
PloS one, 7(1), e30674-e30674 (2012-02-01)
Many studies suggest that far-infrared (FIR) therapy can reduce the frequency of some vascular-related diseases. The non-thermal effect of FIR was recently found to play a role in the long-term protective effect on vascular function, but its molecular mechanism is
Julien M D Legrand et al.
Nature communications, 10(1), 2278-2278 (2019-05-28)
Mammalian spermatogenesis is sustained by mitotic germ cells with self-renewal potential known as undifferentiated spermatogonia. Maintenance of undifferentiated spermatogonia and spermatogenesis is dependent on tightly co-ordinated transcriptional and post-transcriptional mechanisms. The RNA helicase DDX5 is expressed by spermatogonia but roles

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.