Direkt zum Inhalt
Merck

EHU083661

Sigma-Aldrich

MISSION® esiRNA

targeting human WT1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGGGCATGTGTATGTGTCTGCTAATGTAAACTTTGTCATGGTTTCCATTTACTAACAGCAACAGCAAGAAATAAATCAGAGAGCAAGGCATCGGGGGTGAATCTTGTCTAACATTCCCGAGGTCAGCCAGGCTGCTAACCTGGAAAGCAGGATGTAGTTCTGCCAGGCAACTTTTAAAGCTCATGCATTTCAAGCAGCTGAAGAAAAAATCAGAACTAACCAGTACCTCTGTATAGAAATCTAAAAGAATTTTACCATTCAGTTAATTCAATGTGAACACTGGCACACTGCTCTTAAGAAACTATGAAGATCTGAGATTTTTTTGTGTATGTTTTTGACTCTTTTGAGTGGTAATCATATGTGTCTTTATAGATGTACATACCTCCTTGCACAAATGGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xue Wang et al.
Theriogenology, 148, 8-17 (2020-03-04)
To determine the role of 3, 3', 5-triiodo-L thyroxine (T3) in the differentiation of Sertoli cells (SCs) and the factors influencing maturity via the Wilms' tumor 1 (WT1)/non-canonical Wnt signaling pathway, high purity SCs were isolated from newborn calves' testes
Junjie Chen et al.
Journal of experimental & clinical cancer research : CR, 35(1), 173-173 (2016-11-09)
The metastatic cascade is a complex and multistep process with many potential barriers. Recently, miR-193a has been reported to be a suppressive miRNA in multiple types of cancers, but its underlying anti-oncogenic activity in non-small cell lung cancers (NSCLC) is
Tove Ullmark et al.
Biochemical and biophysical research communications, 482(4), 802-807 (2016-11-28)
Wilms' tumor gene 1 (WT1) is a zinc finger transcription factor that has been implicated as an oncogene in leukemia and several other malignancies. When investigating possible gene expression network partners of WT1 in a large acute myeloid leukemia (AML)
Xue Wang et al.
Reproduction, fertility, and development, 32(5), 522-530 (2020-02-06)
The gap junction protein connexin (Cx) 43 between adjacent Sertoli cells (SCs) is the main testicular factor regulating the growth and development of SCs, and plays a vital role in controlling cell differentiation and maturation. However, the endogenous testicular factors
Paramahamsa Maturu et al.
Neoplasia (New York, N.Y.), 19(3), 237-249 (2017-03-04)
Wilms' tumors (WT), which accountfor 6% of all childhood cancers, arise from dysregulated differentiation of nephrogenic progenitor cells from embryonic kidneys. Though there is an improvement in the prognosis of WT, still 10% of patients with WT die due to

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.