Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU079681

Sigma-Aldrich

MISSION® esiRNA

targeting human S1PR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCCCTCCTCAACGTTCTTTTACTTTATACTTTAACTACCTGAGAGTTATCAGAGCTGGGGTTGTGGAATGATCGATCATCTATAGCAAATAGGCTATGTTGAGTACGTAGGCTGTGGGAAGATGAAGATGGTTTGGAGGTGTAAAACAATGTCCTTCGCTGAGGCCAAAGTTTCCATGTAAGCGGGATCCGTTTTTTGGAATTTGGTTGAAGTCACTTTGATTTCTTTAAAAAACATCTTTTCAATGAAATGTGTTACCATTTCATATCCATTGAAGCCGAAATCTGCATAAGGAAGCCCACTTTATCTAAATGATATTAGCCAGGATCCTTGGTGTCCTAGGAGAAACAGACAAGCAAAACAAAGTGAAAACCGAATGGATTAACTTTTGCAAACCAAGGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000170989

NCBI-Hinterlegungsnummer

NM_001400

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... S1PR1(1901) , S1PR1(1901)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lan Xiao et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 33(6), 1090-1104 (2018-01-30)
Accumulating evidence indicates that the immune and skeletal systems interact with each other through various regulators during the osteoclastogenic process. Among these regulators, the bioactive lipid sphingosine-1-phosphate (S1P), which is synthesized by sphingosine kinase 1/2 (SPHK1/2), has recently been recognized
Akira Nomachi et al.
PloS one, 8(12), e82590-e82590 (2013-12-21)
The lipid mediator sphingosine 1-phosphate (S1P) regulates a wide range of cellular activities, including vascular maturation, angiogenesis, and immune-cell trafficking. Among the five known receptors for S1P (S1PR1-S1PR5), S1PR1 is a critical regulator of lymphocyte trafficking: its signaling is required
Shilun Zuo et al.
Molecular neurobiology, 54(2), 1213-1228 (2016-01-29)
Blood-brain barrier preservation plays an important role in attenuating vasogenic brain edema after subarachnoid hemorrhage (SAH). This study was designed to investigate the protective effect and mechanism of artesunate, a traditional anti-malaria drug, on blood-brain barrier after SAH. Three hundred
Veronica Lifshitz et al.
Molecular cancer therapeutics, 16(11), 2516-2527 (2017-07-19)
Drug resistance is a major barrier for the development of effective and durable cancer therapies. Overcoming this challenge requires further defining the cellular and molecular mechanisms underlying drug resistance, both acquired and environment-mediated drug resistance (EMDR). Here, using neuroblastoma (NB)
H-X Wu et al.
European review for medical and pharmacological sciences, 21(1), 108-114 (2017-01-26)
MicroRNAs (miRs) regulate the proliferation and metastasis of numerous cancer cell types. This study aimed to reveal the role of microRNA-542-3p (miR-542-3p) in breast cancer (BC) cell proliferation and its potential mechanisms. MiR-542-3p expression was detected by reverse transcription-polymerase chain
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.