Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU078251

Sigma-Aldrich

MISSION® esiRNA

targeting human CTH

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAGTATTCCAGAGCTGCTATTAGAAGCTGCTTCCTGTGAAGATCAAATCTTCCTGAGTAATTAAATGGACCAACAATGAGCCTTTGCAAAATTTTCAAGCGGAAATTTTAAGGCACCTCATTATCTTTCATAACTGTAATTTTCTTAGGGATCATCTCTGTTAAAAAGTTTTCTGTATGTCATGTTATAATTACAGGTCAATTCTGTTAATATCTTTTTGTTAATTTTGCTCTATGTTTGCCTCTGAAGGAGGT

Ensembl | Human Hinterlegungsnummer

ENSG00000116761

NCBI-Hinterlegungsnummer

NM_001902

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CTH(1491) , CTH(1491)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number
SNS

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Suche nach COA

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhongjian Cheng et al.
Circulation, 134(19), 1467-1483 (2016-09-24)
Bone marrow cell (BMC)-based treatment for critical limb ischemia in diabetic patients yielded a modest therapeutic effect resulting from cell dysfunction. Therefore, approaches that improve diabetic stem/progenitor cell functions may provide therapeutic benefits. Here, we tested the hypothesis that restoration
Neil Dufton et al.
Scientific reports, 2, 499-499 (2012-07-13)
Hydrogen sulfide is an essential gasotransmitter associated with numerous pathologies. We assert that hydrogen sulfide plays an important role in regulating macrophage function in response to subsequent inflammatory stimuli, promoting clearance of leukocyte infiltrate and reducing TNF-α levels in vivo
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has
Qian-Rong Qi et al.
Endocrinology, 161(11) (2020-09-29)
Angiogenesis is a physiological process for endometrial regeneration in the menstrual cycle and remodeling during pregnancy. Endogenous hydrogen sulfide (H2S), produced by cystathionine-β synthase (CBS) and cystathionine-γ lyase (CSE), is a potent proangiogenic factor; yet, whether the H2S system is
Daoliang Xu et al.
Pharmacological research, 117, 357-369 (2017-01-15)
It has been suggested that excessive apoptosis in intervertebral disc cells induced by inflammatory cytokines, such as interleukin (IL)-1β, is related to the process of intervertebral disc degeneration (IVDD). Hydrogen sulfide (H
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.