Direkt zum Inhalt
Merck

EHU078241

Sigma-Aldrich

MISSION® esiRNA

targeting human TJP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Alan S Fanning et al.
Molecular biology of the cell, 23(4), 577-590 (2011-12-23)
The structure and function of both adherens (AJ) and tight (TJ) junctions are dependent on the cortical actin cytoskeleton. The zonula occludens (ZO)-1 and -2 proteins have context-dependent interactions with both junction types and bind directly to F-actin and other
Alexander X Cartagena-Rivera et al.
Nature communications, 8(1), 1030-1030 (2017-10-19)
Maintenance of epithelial tissue integrity requires coordination between cell-cell adherens junctions, tight junctions (TJ), and the perijunctional actomyosin cytoskeleton. Here we addressed the hypothesis that alterations in TJ structure and remodeling of the actomyosin cytoskeleton modify epithelial mechanics. Current methods

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.