Direkt zum Inhalt
Merck

EHU077321

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qianfeng Zhuang et al.
Acta biochimica et biophysica Sinica, 50(5), 465-472 (2018-04-13)
Calpain small subunit 1 (Capn4) has been shown to correlate with the metastasis/invasion of clear cell renal cell carcinoma (ccRCC). This study aimed to further elucidate the molecular mechanisms underlying Capn4-mediated ccRCC progression. The mRNA expression levels in ccRCC cells
Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Chang Liu et al.
Cancer medicine, 10(1), 337-349 (2020-12-07)
Lidocaine, one of the most commonly used local anesthetics during surgery, has been reported to suppress cancer cell growth via blocking voltage-gated sodium channels (VGSCs). VGSC 1.5 (NaV 1.5) is highly expressed in invasive cancers including ovarian cancer. This study
Dariusz Lachowski et al.
Scientific reports, 7(1), 2506-2506 (2017-06-02)
Pancreatic Ductal Adenocarcinoma (PDAC) is an aggressive malignancy characterised by the presence of extensive desmoplasia, thought to be responsible for the poor response of patients to systemic therapies. Pancreatic stellate cells (PSCs) are key mediators in the production of this
Qiqiao Du et al.
Frontiers in oncology, 10, 36-36 (2020-03-03)
Background: Cervical cancer remains a leading cause of death in women due to metastasis to distant tissues and organs. Integrins are involved in cancer metastasis. However, whether integrin α3 participates in cervical cancer metastasis is under investigation. In this study

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.