Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU077121

Sigma-Aldrich

MISSION® esiRNA

targeting human OCLN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAGAAGGCTGATGCCAAGTTGTTTGA

Ensembl | Human Hinterlegungsnummer

ENSG00000197822

NCBI-Hinterlegungsnummer

NM_002538

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... OCLN(100506658) , OCLN(4950)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

James Keaney et al.
Science advances, 1(8), e1500472-e1500472 (2015-10-23)
The blood-brain barrier (BBB) is essential for maintaining brain homeostasis and protecting neural tissue from damaging blood-borne agents. The barrier is characterized by endothelial tight junctions that limit passive paracellular diffusion of polar solutes and macromolecules from blood to brain.
Kentaro Jingushi et al.
International journal of oncology, 51(1), 289-297 (2017-05-24)
Renal cell carcinoma (RCC) is the most common neoplasm of the adult kidney, and clear cell RCC (ccRCC) represents its most common histological subtype. Although several studies have reported high expression of miR-122 in ccRCC, its physiological role remains unclear.
Thomas Volksdorf et al.
The American journal of pathology, 187(6), 1301-1312 (2017-04-17)
Tight junction (TJ) proteins are known to be involved in proliferation and differentiation. These processes are essential for normal skin wound healing. Here, we investigated the TJ proteins claudin-1 and occludin in ex vivo skin wound healing models and tissue samples
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Dalia S Elhelw et al.
Archives of virology, 162(11), 3283-3291 (2017-06-24)
Occludin (OCLN) is an essential factor for HCV entry through interacting with other surface receptors. The aim of this study was to investigate the epigenetic regulation of Occludin expression and to study its impact on viral infectivity. microRNAs expression was
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.