Direkt zum Inhalt
Merck

EHU076261

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCC1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGATGTCATCTGAAATGGAAACCAACATCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGAATTCCGGAACTACTGCCTGCGCTACCGAGAGGACCTGGACTTCGTTCTCAGGCACATCAATGTCACGATCAATGGGGGAGAAAAGGTCGGCATCGTGGGGCGGACGGGAGCTGGGAAGTCGTCCCTGACCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAGGAGAGATCATCATCGATGGCATCAACATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAAGATCACCATCATCCCCCAGGACCCTGTTTTGTTTTCGGGTTCCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dalila Naci et al.
Scientific reports, 9(1), 19455-19455 (2019-12-21)
Chemoresistance is a major hurdle in anti-cancer therapy. Growing evidence indicates that integrin-mediated cell adhesion to extracellular matrix plays a major role in chemoresistance. However, the underlying mechanisms are not fully understood. We have previously shown that the collagen-binding integrin
F Anthony Willyerd et al.
Journal of neurotrauma, 33(2), 226-231 (2015-04-22)
Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI)
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed
M Hasanzadeh Kafshgari et al.
Biomaterials science, 3(12), 1555-1565 (2015-09-08)
In this study, thermally hydrocarbonised porous silicon nanoparticles (THCpSiNPs) capped with polyethylenimine (PEI) were fabricated, and their potential for small interfering RNA (siRNA) delivery was investigated in an in vitro glioblastoma model. PEI coating following siRNA loading enhanced the sustained

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.